We narrowed to 17,518 results for: Emb
-
Plasmid#166840PurposeExpresses ER localized Vac8-GFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsGFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only
-
myc-Miro2 (lacking TM)
Plasmid#127614PurposeHuman Miro2 with the transmembrane deletedDepositorAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti4 Blast RFP-PNRC1 W300A
Plasmid#123298PurposeMammalian expression of PNRC1-W300A mutant N-RFPDepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti C-MYC-DDK Puro PNRC1
Plasmid#123300PurposeMammalian expression of PNRC1 C-MYC-FLAGDepositorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_m-AKAR5
Plasmid#114139PurposeMammalian expression of the AKAR5 sensor C-terminally fused to the C-terminus of KRas (membrane targeting) for detecting PKA activity using two-photon fluorescence lifetime imaging microscopy (2pFLIM)DepositorInsertAKAR5 C-terminally tagged by KRas C tail
ExpressionMammalianAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJ4M/TDP-43
Plasmid#104480Purposebacterial expression of TDP-43DepositorAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-GRAM-H
Plasmid#211700PurposeExpression of EGFP-tagged GRAM domain of GRAMD1b carrying a G187L mutation (EGFP-GRAM1b G187L) in mammalian cellsDepositorInsertGRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
TagsEGFPExpressionMammalianMutationChanged Glycine 187 to LeucinePromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p1-GST-Rnf31
Plasmid#63134PurposeExpression of human RNF31/HOIP codon optimized for E. coli and insect cellsDepositorInsertRnf31 (RNF31 Human, Synthetic)
TagsGSTExpressionBacterialMutationSynthetic based on human protein sequencePromotertacAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dC_mKate2
Plasmid#167336PurposeExpresses mKatet2 fused to TFAM dC-tail mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_NTD1-80_E17R
Plasmid#104479Purposebacterial expression of TDP-43 NTD E17RDepositorAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_HMGA_linker_mKate2
Plasmid#167335PurposeExpresses mKate2 fused to TFAM HMGA+linker mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dimer_mKate2
Plasmid#167333PurposeExpresses mKate2 fused to TFAM no-dimerization mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationChanged K95A, Y99F, E106A, E112A and R116APromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_HMGA_mKate2
Plasmid#167334PurposeExpresses mKate2 fused to TFAM HMGA mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) and HMGA …PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human_TFAM_dHMGA_pET28
Plasmid#167329PurposeExpresses TFAM dHMGA mutant in bacterial cellsDepositorInsertTFAM (TFAM Human)
Tags6XHisExpressionBacterialMutationTruncation mutant containing linker, HMGB, and C-…PromoterT7Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJ4M/TDP-43 S48E
Plasmid#104481Purposebacterial expression of TDP-43 S48EDepositorAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_NTD1-80_Y4R
Plasmid#104478Purposebacterial expression of TDP-43 NTD Y4RDepositorAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AviMta3-3xFiBsd
Plasmid#140962Purposefull-length wt Avi-Mta3-3XFLAG-iBsd cDNA w/CAG promoter and Blasticidin resistance, cloned from mouse ES cellsDepositorInsertmetastasis associated 3 (Mta3 Mouse, Synthetic)
Tags3xFLAG, Avi, and TEVExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1281)
Plasmid#192955PurposeFor membrane insertion study; Expresses tse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1281)
ExpressionBacterialMutationencodes for tse5 (1169-1281)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1229)
Plasmid#192948PurposeFor membrane insertion study; expresses Tse5-CT (1169-1229)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1229)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1229)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1300)
Plasmid#192956PurposeFor membrane insertion study; Expresses tse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1300)
ExpressionBacterialMutationencodes for tse5 (1169-1300)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1317)
Plasmid#192957PurposeFor membrane insertion study; Expresses tse5-CT (1169-1317) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1317)
ExpressionBacterialMutationencodes for tse5 (1169-1317)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1269)
Plasmid#192954PurposeFor membrane insertion study; Expresses tse5-CT (1169-1269) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1269)
ExpressionBacterialMutationencodes for tse5 (1169-1269)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1229)
Plasmid#192953PurposeFor membrane insertion study; Expresses tse5-CT (1169-1229) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1229)
ExpressionBacterialMutationencodes for tse5 (1169-1229)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1281)
Plasmid#192950PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1281)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1281)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1269)
Plasmid#192949PurposeFor membrane insertion study; Expresses Tse5-CT (1169-1269)/PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1269)
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1269)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKTop::sptse5-CT (1169-1300)
Plasmid#192951PurposeFor membrane insertion study; Expresses sptse5-CT (1169-1300) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInsertsptse5-CT (1169-1300)
TagsPelB signal peptideExpressionBacterialMutationencodes for sptse5 (1169-1300)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet1-6xHis-TEV-NDP52
Plasmid#190194PurposePlasmid for the protein expression of 6xHis-TEV-NDP52 in a bacterial expression system. Internal reference: SMC401DepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_L6_mKate2
Plasmid#167332PurposeExpresses mKate2 fused to TFAM L6 mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationChanged K136, H137, K139, R140, K146 and K147 to …PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti C-MYC-DDK Puro PNRC1-W300A
Plasmid#123301PurposeMammalian expression of PNRC1-W300A mutant C-MYC-FLAGDepositorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p1-Rbck1
Plasmid#63135PurposeExpression of human RBCK1/HOIL-1LDepositorInsertHOIL-1L (RBCK1 Human, Synthetic)
TagsGSTExpressionBacterialMutationSynthetic based on human protein sequencePromotertacAvailable SinceMarch 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLAG-puro-PTPIP51(1-150_175-470)
Plasmid#170537PurposeExpresses PTPIP51 FFAT-like motif (151-175) deletion mutant (1-150_176-470) in human HeLa cells after transfectionDepositorInsertProtein tyrosine phosphatase interacting protein 51 (RMDN3 Human)
TagsFLAG tagExpressionMammalianMutationdeleted amino acids 151-175PromoterCAG promoterAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dHMGA_mKate2_CLEAVAGE
Plasmid#167337PurposeExpresses mKate2 fused to TFAM dHMGA mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-mEGFP-MBP-TMD(ALA7)
Plasmid#193051PurposeExpression of artificial transmembrane protein tagged with mEGFP and MBP at the plasma membrane. Control construct for single molecule co-localization and co-tracking microscopy.DepositorInsertALA7-TMD
TagsIg k-chain leader sequence, MBP, and mEGFPExpressionMammalianPromoterCMVAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A32
Plasmid#191241PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A32 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A31
Plasmid#191242PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A31 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-CP8B1
Plasmid#191240PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-CP8B1 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), CYP8B1 (CYP12) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_HMGB_ctail_mKate2_CLEAVAGE
Plasmid#167338PurposeExpresses mKate2 fused to TFAM HMGB+C-tail mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
Plasmid#169168PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.DepositorInsertMAP1LC3B (MAP1LC3B Human)
Tags6X Histidine Tag, TEV cleavage site, mCherryExpressionBacterialPromoterT7 lac promoterAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only