We narrowed to 400 results for: Superfolder GFP
-
Plasmid#240226PurposeGateway entry clone with TurboID tagged with superfolder GFP (contains stop codon)DepositorInsertsfGFP-TurboID
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRMC2-tat:msfGFP
Plasmid#194915PurposeTetracycline inducible expression of msfGFP fused to Tat signal peptide in StaphylococciDepositorInsertShine Dalgarno sequence followed by Tat signal peptide fused to monomeric superfolder GFP
UseTetracycline-inducible expression vector for stap…ExpressionBacterialAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
psfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164477PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry.DepositorAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-PQRv3-RFP
Plasmid#73951PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.DepositorInsertssfGFP (superfolder GFP)
RFP
TagsA residual PQR peptide wii be left at the C-termi…ExpressionMammalianPromoterChicken beta actin and Chicken beta actin (shared…Available SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUS252
Plasmid#127674PurposeExpresses fuGFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFP to place in other plasmid backbonesDepositorInsertFree Use GFP (fuGFP)
ExpressionBacterialPromoterlacAvailable SinceJune 24, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLQ5079_pHR_PGK_sfGFP_CoV-F1
Plasmid#155303PurposeSARS-CoV-2 fluorescent reporter 1DepositorInsertSuperfolder GFP fused with SARS-CoV-F1 (ORF1ab Synthetic)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti sfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164478PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry. Plasmid for lentivirus production.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsmCherry and superfolder GFPExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TfR-sfGFP-myc tag-SpyCatcher003
Plasmid#133451PurposeExpresses SpyCatcher003 for display at the cell surface of mammalian cells, with superfolder GFP for visualization and myc tag for antibody detectionDepositorInsertTfR-sfGFP-myc tag-SpyCatcher003
TagsGSSGS and myc tagExpressionMammalianMutationContains C20 and A23 mutations that improve plasm…PromoterCMVAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-mEYFP
Plasmid#218968PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mEYFPDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA-Sec7-mGold
Plasmid#218967PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mGoldDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-sfGFP*-XcP4H-MH4R
Plasmid#178043PurposeExpress green fluorescent protein with TAG at 151 position and enzymes to biosynthesize 5HTPDepositorInsertssuperfolder green fluorescent protein with TAG at 151 position
XcP4H with W179F mutation
dihydropterine reductase from human
pterin-4a-carbinolamine dehydratase from human
TagsHis tagExpressionBacterialAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Cdk6-T2A-td-sfGFP-FNF-TK
Plasmid#134321PurposeB6J Cdk6-T2A-td-sfGFP allele targeting vector, low copy numberDepositorInsertCdk6 (Cdk6 Mouse)
UseMouse TargetingTagsC-terminal fusion of T2A-tandem dimer-superfolder…Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUS252y
Plasmid#191834PurposeExpresses fuYFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuYFP to place in other plasmid backbones.DepositorInsertfuYFP
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252L
Plasmid#191832PurposeExpresses fuBFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuBFP to place in other plasmid backbonesDepositorInsertfuBFP
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252b
Plasmid#191831PurposeExpresses fuGFPb constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFPb to place in other plasmid backbonesDepositorInsertfuGFPb
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252s
Plasmid#191833PurposeExpresses fuGFPs constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFPs to place in other plasmid backbonesDepositorInsertfuGFPs
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits