We narrowed to 392 results for: Superfolder GFP
-
Plasmid#155303PurposeSARS-CoV-2 fluorescent reporter 1DepositorInsertSuperfolder GFP fused with SARS-CoV-F1 (ORF1ab Synthetic)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti sfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164478PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry. Plasmid for lentivirus production.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsmCherry and superfolder GFPExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TfR-sfGFP-myc tag-SpyCatcher003
Plasmid#133451PurposeExpresses SpyCatcher003 for display at the cell surface of mammalian cells, with superfolder GFP for visualization and myc tag for antibody detectionDepositorInsertTfR-sfGFP-myc tag-SpyCatcher003
TagsGSSGS and myc tagExpressionMammalianMutationContains C20 and A23 mutations that improve plasm…PromoterCMVAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUS252y
Plasmid#191834PurposeExpresses fuYFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuYFP to place in other plasmid backbones.DepositorInsertfuYFP
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252L
Plasmid#191832PurposeExpresses fuBFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuBFP to place in other plasmid backbonesDepositorInsertfuBFP
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252b
Plasmid#191831PurposeExpresses fuGFPb constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFPb to place in other plasmid backbonesDepositorInsertfuGFPb
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUS252s
Plasmid#191833PurposeExpresses fuGFPs constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFPs to place in other plasmid backbonesDepositorInsertfuGFPs
ExpressionBacterialAvailable SinceJan. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUSE-URA3-Sec7-mEYFP
Plasmid#218968PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mEYFPDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA-Sec7-mGold
Plasmid#218967PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mGoldDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-sfGFP*-XcP4H-MH4R
Plasmid#178043PurposeExpress green fluorescent protein with TAG at 151 position and enzymes to biosynthesize 5HTPDepositorInsertssuperfolder green fluorescent protein with TAG at 151 position
XcP4H with W179F mutation
dihydropterine reductase from human
pterin-4a-carbinolamine dehydratase from human
TagsHis tagExpressionBacterialAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY71-PT7-RiboJ-sfGFP-MGapt
Plasmid#129119PurposeExpresses a fluorescent reporter for the quantification of cell-free protein expression.DepositorInsertSuperfolder GFP with Malachite Green aptamer
UseSynthetic BiologyTagsHis6 and RiboJ InsulatorExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Cdk6-T2A-td-sfGFP-FNF-TK
Plasmid#134321PurposeB6J Cdk6-T2A-td-sfGFP allele targeting vector, low copy numberDepositorInsertCdk6 (Cdk6 Mouse)
UseMouse TargetingTagsC-terminal fusion of T2A-tandem dimer-superfolder…Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR_BIP-sfGFP-TurboID-KDEL
Plasmid#240223PurposeGateway entry clone with ER-localized TurboID tagged with superfolder GFP (contains stop codon)DepositorInsertBIP-sfGFP-TurboID-KDEL
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-scFv-GCN4-sfGFP-GB1-NLS-iLID-dWPRE
Plasmid#121966PurposeExpresses fusion of single chain variable fragment recognizing SunTag, fluorescent protein sfGFP, and iLID which upon light activation binds to sspB.DepositorInsertscFv-GCN4
UseLentiviralTagssuperfold GFP-GB1-NLS-iLIDExpressionMammalianPromoterSFFVAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5080_pHR_PGK_sfGFP_CoV-F2
Plasmid#155304PurposeSARS-CoV-2 fluorescent reporter 2DepositorUseLentiviralExpressionMammalianPromoterPGKAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i5-msfGFP
Plasmid#180327Purposemammalian expression of human SEPT9_i5 fused to monomeric superfolder GFPDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1-msfGFP
Plasmid#180328Purposemammalian expression of human SEPT9_i1 fused to monomeric superfolder GFPDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-msfGFP
Plasmid#180322Purposemammalian expression of human SEPT9_i3 fused to monomeric superfolder GFPDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only