We narrowed to 7,541 results for: URE
-
Plasmid#98876PurposeIn vivo visualization of mitochondria (can be used for colocalization studies)DepositorInsert4xmts
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tubulin-6
Plasmid#56450PurposeLocalization: Microtubules, Excitation: 488, Emission: 507DepositorAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
ER-mNeonGreen
Plasmid#137804PurposeVisualization of the Endoplasmic ReticulumDepositorInsertKDEL
ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ERKKTRClover
Plasmid#59138PurposeORF encoding ERK KTR mClover flanked by Gateway sequencesDepositorInsertERK Kinase Translocation Reporter (MAPK1 Human, Mouse)
Available SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBB542
Plasmid#27395DepositorInsertdnaK, dnaJ, groESL
ExpressionBacterialAvailable SinceSept. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-Nanog
Plasmid#28221DepositorAvailable SinceMarch 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK DEST H2B-iRFP670
Plasmid#90237PurposeLentiviral vector to express H2B-iRFP670 under PGK promoterDepositorInsertH2B
UseLentiviralTagsiRFP670ExpressionMammalianPromoterPGKAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO hChR2(H134R)-EYFP
Plasmid#55639PurposeFlp-Dependent ChR2-EYFPDepositorHas ServiceAAV RetrogradeInserthChR2(H134R)-EYFP
UseAAVTagsEYFPExpressionMammalianPromoterEf1aAvailable SinceAug. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWZL hygro H-Ras V12
Plasmid#18749DepositorAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mCherry-IRES-Flpo
Plasmid#55634PurposeExpresses Flpo in Mammalian CellsDepositorHas ServiceAAV Retrograde and AAV1InsertsmCherry
Flpo
UseAAVExpressionMammalianPromoterEf1a and Ef1a/IRESAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
BFP-Rab5
Plasmid#49147Purposemammalian expression of TagBFP-Rab5 fusionDepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBA904
Plasmid#122238PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBa-LSS-GFP-LDLR wt
Plasmid#98184PurposeLow Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.DepositorInsertLDLR (LDLR Human)
TagsGFP and LDLR signal sequence, N-term of GFP so GF…ExpressionMammalianMutationnonePromoterChicken Beta ActinAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-3xFLAG-V5-ccdB
Plasmid#87072PurposeLentiviral Gateway-compatible expression vector backbone with a N-terminal 3xFLAG-V5 tagDepositorTypeEmpty backboneUseLentiviralTags3xFLAG-V5ExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
tetO-MEF2C
Plasmid#46031DepositorAvailable SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-TeLC-P2A-dTomato
Plasmid#159102PurposeCre-dependent tetanus toxin light chain construct with nuclear-localized dTomato fluorophore for conditional silencing of neurons.DepositorInsertTeLC-P2A-NLS-dTomato
UseAAVPromoterhSynapsinAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET23b-15F11-HA-mEGFP-6xHis
Plasmid#129593PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mEGFP and His-tag. This plasmid is for bacteria protein expression under T7 promoter and protein purification with HisTrap.DepositorInsertAnti-HA frankenbody-mEGFP (15F11-HA scFv-mEGFP)
Tags6xHis-tagExpressionBacterialPromoterT7Available SinceAug. 15, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits