We narrowed to 3,286 results for: cat.3
-
Plasmid#215929PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [EnAs]; sgCD4_v1 [EnAs]; DR_v1 [EnAs]; sgCD4_v2 [EnAs];
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-Rh159-HA
Plasmid#179344PurposeAll-in-on "tet-on" 3G lentiviral vector plasmid encoding rhesus cytomegalovirus Rh159 (NK cell evasion protein) with a C-terminal HA tag fused to its cytoplasmic tailDepositorInsertRh159
UseLentiviral; All in one tet-on lentiviral vector (…TagsHA tagExpressionMammalianPromotertet responsive element 3GAvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria3-GFP KI
Plasmid#131491PurposeEndogenous tagging of GluA3: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMK188
Plasmid#226659PurposepCB2.4 - pBR322 shuttle vector that replicates in E. coli and Synechococcus sp. PCC 7002, contains HIP1 siteDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMK191
Plasmid#226658PurposeBroad host range WVO1 vector that replicates in Synechococcus sp. PCC 7002, GentR, contains HIP1 siteDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMK74
Plasmid#226657PurposeBroad host range WVO1 vector that replicates in Synechococcus sp. PCC 7002, KanR, contains HIP1 siteDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
BCR/ABL P190 transgenic construct
Plasmid#38185DepositorUseConstruct for making transgenic micePromotertruncated mouse MT promoterAvailable SinceOct. 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKK-MBP-TEV
Plasmid#105771PurposeExpression of your protein of interest in fusion with MBP at the N-terminus (cleavable by TEV). The maltose binding protein tag allows convenient purification of proteins (PMID: 22442034, 19935684).DepositorTypeEmpty backboneUseFlp-in competentTagsMBP-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-ProteinA
Plasmid#105788PurposeExpression of your protein of interest in fusion with two IgG binding domains of Staphylococcus aureus protein A at the C-terminus (cleavable by TEV) (PMID: 3507693, 10504710). Protein purification.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-ProteinAExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-hRNF216(457-784)
Plasmid#171922PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic helix-RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-MBP
Plasmid#105787PurposeExpression of your protein of interest in fusion with MBP at the C-terminus (cleavable by TEV). The maltose binding protein tag allows convenient purification of proteins (PMID: 22442034, 19935684).DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-MBPExpressionMammalianAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cntn3-AP-His
Plasmid#71941PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/t35s[TMV]:mNeonGreen-CI{PDK-198}:NosT
Plasmid#212176PurposeThis binary vector expresses mNeonGreen containing the catalase (PDK) intron (390 bp into the gene) with extra 3' splice site removed (corrected intron) with the truncated 35sCAMV promoter and TMV UTRDepositorInsertTomato codon optimized version of mNeonGreen-I{PDK-198}
ExpressionPlantMutationmNeonGreen codon-optimized for tomato and PDK int…Promotertruncated 35sCaMVAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458_TGIF2_2
Plasmid#72375PurposeEncodes gRNA for 3' target of human TGIF2 along with Cas9 with 2A GFPDepositorInsertTGIF2 (TGIF2 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF146_1
Plasmid#72360PurposeEncodes gRNA for 3' target of human ZNF146 along with Cas9 with 2A GFPDepositorInsertZNF146 (ZNF146 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF146_2
Plasmid#72361PurposeEncodes gRNA for 3' target of human ZNF146 along with Cas9 with 2A GFPDepositorInsertZNF146 (ZNF146 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPD162.21
Plasmid#27511DepositorInsertpmyo-3::dsRed::let-858_3'UTR
ExpressionWormAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHZ054
Plasmid#27505DepositorInsertpmyo-3::yfp::lin-14_3'UTR
ExpressionWormAvailable SinceMarch 10, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV 3xgRNA KO;Rbfox3
Plasmid#240311PurposeKO:NeuNDepositorInsertKO gRNAs for NeuN
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only