We narrowed to 31,702 results for: FER
-
Plasmid#182547PurposeExpresses a sfGFP fused H5 protein of the prototype A/Vietnam/1203/04 virus with a Y161A mutations conferring Neu5Gc specificityDepositorInsertH5_Vietnam_1203_04_Y161A
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianMutationY161A mutant that confers exclusive NeuAc to NeuG…PromoterCMVAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-ADGRL1-201
Plasmid#117336PurposeDual luciferase assay for miRNA-targeted UTRDepositorInsert3' UTR ADGRL1-201
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF714-pET28a-Hs-FL-METTL20-NHis wt
Plasmid#85115Purposeexpression of recombinant human full-length METTL20 wt with N-terminal 6xHis-tagDepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF711-pET28a-Hs-delta25-MCAD-NHis wt
Plasmid#85112Purposeexpression of recombinant human mature (delta25) MCAD wt with N-terminal 6xHis-tagDepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_TSS1
Plasmid#210633PurposeLuciferase experiment for TAL1 TSS1DepositorInsertTAL1 TSS1 (TAL1 Human)
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_TSS2
Plasmid#210634PurposeLuciferase experiment for TAL1 TSS2DepositorInsertTAL1 TSS2 (TAL1 Human)
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_TSS4
Plasmid#210635PurposeLuciferase experiment for TAL1 TSS4DepositorInsertTAL1 TSS4 (TAL1 Human)
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23_TSS5
Plasmid#210636PurposeLuciferase experiment for TAL1 TSS5DepositorInsertTAL1 TSS5 (TAL1 Human)
ExpressionMammalianAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAM2_mCherry_Tbx5
Plasmid#72688PurposeDoxycyline regulated expression of Tbx5 in mammalian cellsDepositorAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-CMV2 MAML LHHLL
Plasmid#87681PurposeMammalian expression vector for Maml1 with LHHLL mutationDepositorInsertMAML1 (MAML1 Human)
TagsFlagExpressionMammalianMutationMutate 1010,1011 from DD to HHPromoterCMVAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_CEACAM1
Plasmid#140102PurposeCRISPR-Cas9 library validationDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL-p21UTRm1
Plasmid#20878DepositorInsertp21 3'UTR site 1 mutation (Cdkn1a Mouse)
UseLuciferaseExpressionMammalianMutationPredicted miRNA binding site 1 (Position ~420) GC…Available SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-SERINC2-202
Plasmid#117364PurposeDual luciferase assay for miRNA-targeted UTRDepositorInsert3' UTR SERINC2-202
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_Rat_cebp-alfa
Plasmid#140098PurposeCRISPR-Cas9 library validation (positive control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_SPI1
Plasmid#140099PurposeCRISPR-Cas9 library validation (positive control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-c
Plasmid#53078Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPKm-245
Plasmid#90503PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-BAX-201
Plasmid#117332PurposeDual luciferase assay for miRNA-targeted UTRDepositorInsert3' UTR BAX-201
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only