We narrowed to 23,989 results for: Sis
-
Plasmid#23740DepositorInsertTSSK1 (TSSK1B Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA0482
Plasmid#96968Purposeexpression of methicillin-resistant Staphylococcus aureus orf 0482DepositorInsertMRSA ORF0482
TagsN-ter TEV protease cleavable 6HisExpressionBacterialMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK4
Plasmid#23497DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK11
Plasmid#23816DepositorInsertNEK11 (NEK11 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-STK17B
Plasmid#23721DepositorInsertSTK17B (STK17B Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TSSK2
Plasmid#23397DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK10
Plasmid#23437DepositorInsertNEK10 (NEK10 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Amber
Plasmid#105806PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Amber, cleavable by TEV. Control for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-AmberExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast HA-GPAT4-ΔNs5
Plasmid#173169PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4 with mutation in CHP1 binding siteDepositorInsertGlycerol-3-Phosphate Acyltransferase 4 (GPAT4 Human)
UseRetroviralTagsHAMutationSynonymous mutations at sgRNA sites, amino acids …PromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast 3XFLAG-CHP1-myr_mut
Plasmid#173167PurposeRetroviral vector to express sgRNA resistant 3XFLAG tagged human CHP1 with myristoylation site mutationDepositorInsertCalcineurin Like EF-Hand Protein 1 (CHP1 Human)
UseRetroviralTags3XFLAGMutationSynonymous mutations at sgRNA sites, G2A, S6APromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-RPS14(WT)-Myc
Plasmid#122236Purposeexpresses RPS14 protein with a Myc tag in mammalian cells (hygro resistance)DepositorAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE_DLD-S456A-C-TAP
Plasmid#83479PurposeMammalian expression of the proteolysis-deficient mutant DLD-S456A.DepositorAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-tevopreQ1-epegRNA+13C>G_EF1a-puroR (PBS 14 - RTT 18)
Plasmid#207356PurposeLentiviral transfer plasmid encoding hU6-driven expression of a N1303K-CFTR correcting prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR + 13 C>G tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-YTHDF2-RNA-MUT (nonsense mutation of sgYTHDF2-1)
Plasmid#232948PurposeExpresses the RNA-binding-deficient mutant of YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-RNA-MUT (YTHDF2 Human)
UseLentiviralMutationRNA binding mutation (K416A+R527A), synonymous mu…Available SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGGG-Sr43
Plasmid#186974PurposeSr43 is a wheat stem rust resistance gene transferred from tall wheat grass (Thinopyrum ponticum) into bread wheat (Triticum aestivum).DepositorInsertSr43
TagsNoneExpressionBacterial and PlantMutationNonePromoterNaticeAvailable SinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-tevopreQ1-epegRNA+13C>A_EF1a-puroR (PBS 10 - RTT 19)
Plasmid#207357PurposeLentiviral transfer plasmid encoding hU6-driven expression of a L227R-CFTR correcting prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR + 13 C>A tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7(res) (closed)
Plasmid#160105PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ALS2CR7
Plasmid#23632DepositorInsertALS2CR7 (CDK15 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-LOC389599
Plasmid#23361DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7(res)
Plasmid#160106PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-hCdt1(1-100)ΔCy-mCherry-P2A-mVenus-hGeminin(1-110)-IRES-Blast
Plasmid#193139PurposeExpresses bicistronic P2A construct of C-CRL4Cdt2 reporter(hCdt1(1-100)ΔCy-mCherry-) and APC/C reporter (hGeminin(1-110)) with blasticidin resistanceDepositorUseLentiviralMutationhuman Cdt1 amino acids 1-100 w/ ΔCy mutation (aa6…PromoterEF1aAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NEK2
Plasmid#23658DepositorInsertNEK2 (NEK2 Human)
UseGateway donor vectorMutationInsert encodes truncated protein relative to NP_0…Available SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-EGFP-MTHFD1-WPRE
Plasmid#250370PurposeLentiviral expression of human MTHFD1 with N-terminal EGFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-tagBFP-NUDT5-WPRE
Plasmid#250375PurposeLentiviral expression of human NUDT5 with N-terminal tagBFP under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5-WPRE
Plasmid#250377PurposeLentiviral expression of human NUDT5 with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 Y74E-WPRE
Plasmid#250385PurposeLentiviral expression of human NUDT5 Y74E with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 G150V-WPRE
Plasmid#250402PurposeLentiviral expression of human NUDT5 G150V with N-terminal mCherry seperated by a flexible GSG-linker and P2A under CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationG150VPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 P158I-WPRE
Plasmid#250403PurposeLentiviral expression of human NUDT5 P158I with N-terminal mCherry seperated by a flexible GSG-linker and P2A under CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationP158IPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-2xHA-NUDT5 P158T-WPRE
Plasmid#250383PurposeLentiviral expression of human NUDT5 P158T with N-terminal 2xHA under CMV promoter and puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags2xHAExpressionMammalianMutationP158TPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 W28A-WPRE
Plasmid#250389PurposeLentiviral expression of human NUDT5 W28A with N-terminal mCherry seperated by a flexible GSG-linker and P2A under CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationW28APromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5 T45D-WPRE
Plasmid#250388PurposeLentiviral expression of human NUDT5 T45D with N-terminal mCherry seperated by a flexible GSG-linker and P2Aunder CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTagsmCherry-GSG-P2AExpressionMammalianMutationT45DPromoterCMVAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only