We narrowed to 9,362 results for: CAG
-
Plasmid#205922PurposeExpress mEGFP-tagged fusion protein, SMARCA2_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
AURKB gRNA (BRDN0001146837)
Plasmid#77619Purpose3rd generation lentiviral gRNA plasmid targeting human AURKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #1
Plasmid#61515Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgcggcagctcctagctcagc
UseCRISPRExpressionMammalianAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(5’UTR)-SL-FF
Plasmid#85491PurposeFirefly luciferase under the control of ATP5O 5'UTR followed by a stem-loopDepositorInsert5'UTR of ATP5O followed by stem loop (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianAvailable SinceJan. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458-gR2A_ISO
Plasmid#124808PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a> plasmids to convert expression of rat IgG2a hybridomas to isotype of choice.DepositorInserthSPCas9
Tags3XFLAG and GFPExpressionMammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/V5-Foxa1
Plasmid#105507PurposeMSCV-driven retroviral Foxa1 expression (V5-tagged)DepositorAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC-IRES-Blasti
Plasmid#242462PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_G198R
Plasmid#242465PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199R
Plasmid#242466PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_L199G
Plasmid#242467PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The L199G mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationL199GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-3XFLAG-hASB8_ANK3-4
Plasmid#242468PurposeExpresses human ASB8 protein with an N-terminal 3xFLAG tag along with a puromycin selection marker. The ANK3-4 mutations disrupt XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationANK3-4 = R87A - E95A - K96A - W124G - K128GPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-CMV-myc-XPO1_H10-11
Plasmid#242471PurposeExpresses human XPO1 protein with an N-terminal cMyc tag. The H10-11 mutations disrupt ASB8 binding.DepositorInsertXPO1 (XPO1 Human)
TagscMycExpressionMammalianMutationXPO1 H10-11 = E478A - H481A - V484G - N485G - T48…PromoterCMVAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-EF1A-Tag100-hASB8_G198R
Plasmid#242461PurposeExpresses human ASB8 protein with an N-terminal Tag100 along with a puromycin selection marker. The G198R mutation disrupts XPO1 binding.DepositorInsertASB8 (ASB8 Human)
UseLentiviralTagsTag100ExpressionMammalianMutationG198RPromoterEF1AAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC_K7R-IRES-Blasti
Plasmid#242463PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker. The K7R mutations prevent ubiquitin chain elongation.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#1-puro
Plasmid#231984PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron XBB.1.5
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP
Plasmid#210505Purposeexpresses NTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP component in mammalian cellsDepositorInsertNTOM20-SbMVpC-43LK-iLID(139)-NES-NES-SbMVpN-iLID-SbMVseq-bArr2-TevCs-P2A-EGFP
ExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NLSx2-TVMVpC-43LK-iLID(139)-NES-NES-TVMVpN-iLID-TVMVseq-Src13-GB1-LRP6c
Plasmid#210508Purposeexpresses NLSx2-TVMVpC-43LK-iLID(139)-NES-NES-TVMVpN-iLID-TVMVseq-Src13-GB1-LRP6c component in mammalian cellsDepositorInsertNLSx2-TVMVpC-43LK-iLID(139)-NES-NES-TVMVpN-iLID-TVMVseq-Src13-GB1-LRP6c
TagsGB1ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NTOM20-EGFP-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq--bArr2-TevCs
Plasmid#210516Purposeexpresses NTOM20-EGFP-pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq--bArr2-TevCs component in mammalian cellsDepositorInsertNTOM20-EGFP-pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq--bArr2-TevCs
ExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4(12))-PGKpuro2ABFP-W
Plasmid#200460PurposeLentiviral vector expressing gRNA targeting human CXCR4DepositorInsertCXCR4(12) (CXCR4 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209068PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.DepositorInsertsgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2c#2/Cre
Plasmid#173584PurposeExpresses a Cdkn2c-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cdkn2c (Cdkn2c Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgMga#2/Cre
Plasmid#173602PurposeExpresses a Mga-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Mga (Mga Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-12
Plasmid#129052Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA12 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA12 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-3
Plasmid#129043Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA3 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA3 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
AK9 gRNA (BRDN0001162330)
Plasmid#77690Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001148068)
Plasmid#77403Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYLK gRNA (BRDN0001147172)
Plasmid#77021Purpose3rd generation lentiviral gRNA plasmid targeting human MYLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FGFR1 gRNA (BRDN0001146877)
Plasmid#76068Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001145533)
Plasmid#76034Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR8 JARID2
Plasmid#114443PurposeEntry vector for gateway cloning containing human JARID2 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(46))-PGKpuroBFP-W
Plasmid#200504PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ARID1B_ZNF384
Plasmid#205772PurposeExpress mEGFP-tagged fusion protein, ARID1B_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CREBBP_ZNF384
Plasmid#205796PurposeExpress mEGFP-tagged fusion protein, CREBBP_ZNF384 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR8 PALI1
Plasmid#114442PurposeEntry vector for gateway cloning containing human PALI1 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR8 LCOR
Plasmid#114441PurposeEntry vector for gateway cloning containing human LCOR coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVL-FLAG/His PALI1
Plasmid#114449PurposeInsect baculovirus expression vector containing N terminal FLAG/His tagged human PALI1 coding sequenceDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP-SbMVseq-SbMVp-SbMVseq-FRB-VP16
Plasmid#210506Purposeexpresses PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP-SbMVseq-SbMVp-SbMVseq-FRB-VP16 component in mammalian cellsDepositorInsertPDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP-SbMVseq-SbMVp-SbMVseq-FRB-VP16
TagsMycExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
hSyn-PDGFR-KA2-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP
Plasmid#210509Purposeexpresses PDGFR-KA2-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetR-FKBP component in rat hippocampal neuron cellsDepositorInsertsTagsMycExpressionMammalianPromoterhSynAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(47))-PGKpuroBFP-W
Plasmid#200505PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVL-FLAG/His LCOR
Plasmid#114450PurposeInsect baculovirus expression vector containing N terminal FLAG/His tagged human LCOR coding sequenceDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTo1-qgRNA-pYJA5
Plasmid#217781PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLENTI EF1alpha FLAG/HA-PALI1
Plasmid#114445PurposeMammalian lentiviral expression vector containing N terminal FLAG/HA tagged human PALI1 coding sequenceDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/V5-Foxa1-(P2A)-Flag-Gata5
Plasmid#105509PurposeMSCV-driven retroviral Foxa1 and Gata5 expression (P2A-linked, V5 and Flag-tagged each)DepositorAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide4
Plasmid#125516PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only