We narrowed to 2,378 results for: 1186
-
Plasmid#1186DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
Pdg459-eSp(1.1) V3
Plasmid#226965PurposeCBh-eSpCas9(1.1)-2A-Puro, and 2X hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458 eSp(1.1) V3
Plasmid#226963PurposeCBh-eSpCas9(1.1)-2A-GFP, and hU6-sgRNA (Sp) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
IF-GFP-ATRX
Plasmid#45444PurposeATRX expression vectorDepositorInsertATRX (ATRX Mouse, Human)
TagsGFP and HAExpressionBacterial and MammalianMutationisoform 2, missing codon E124PromoterPCMVAvailable SinceMay 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 GFP V3
Plasmid#226961PurposeCBh-SaCas9-2A-GFP, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SaCas9v3-Puro
Plasmid#178813PurposeSaCas9 with 2A-Puro, and a cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
scFv-sfGFP-DNMT3A1
Plasmid#102278PurposeThe plasmid encodes a single-chain antibody that binds to the GCN4 peptide from the SunTag system, and is fused to a DNA methyltransferase DNMT3A1DepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V3
Plasmid#226956PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA)
Plasmid#92102PurposeExpression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PDG459 V3
Plasmid#226958PurposeCBh-SpCas9-2A-Puro, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSH-CAG-AtAFB2.F74A-IRES-puro
Plasmid#216245PurposeExpress AtAFB2.F74A mutant without tag for AID2DepositorInsertAtAFB2.F74A
UseCRISPR and TALEN; Human safe harbor locus (a avs1…ExpressionMammalianMutationF74A mutationPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSH-EF1a-OsTIR1.F74A-mCherry-IRES-puro
Plasmid#216247PurposeExpress OsTIR1.F74A mutant with mCherry tag for AID2DepositorInsertOsTIR1.F74A
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsmCherryExpressionMammalianPromoterEF1aAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-EGFP
Plasmid#48348PurposeContributes the coding sequence for EGFP as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEGFP
UseGateway entry vectorMutationContains a Kozak sequence. Does not contain a sto…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 GFP V3
Plasmid#226962PurposeCBh-SaCas9-2A-GFP, and hU6-sgRNA (Sa) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-SFFV-rtTA3-IRES-Luc-P2A-mtagBFP
Plasmid#176027Purposeconstruct expresses the reverse tet-responsive transactivator 3 (rtTA3) together with Luciferase (Luc) for bioluminescence in vivo imaging, and mTaqBFP for enriching transgenic cells by flow cytometryDepositorInsertsrtTA3
Luc2
mtagBFP
UseLentiviralAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-pro-alphaf(I)-E2-Crimson
Plasmid#117660PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-pro-alphaf(I)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hOCT3/4-shp53-F + mCherry-2A-puro
Plasmid#74947PurposeDosage control and tracing of reprogramming episomesDepositorInsertOct3/4 (POU5F1 Human)
ExpressionMammalianAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:BRD:tNos (GB1172)
Plasmid#75401PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the BRD Transcriptional RepressorDepositorInsertdCas9:BRD
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only