We narrowed to 6,558 results for: siae
-
Plasmid#89202PurposeExpresses STE4 under control of synthetic promoter containing Zif268 binding sites.DepositorAvailabilityAcademic Institutions and Nonprofits only
-
pILGFP4K
Plasmid#104506PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL1 promoter with yEGFP used as the reporter geneDepositorInsertSpGAL1 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4O
Plasmid#104510PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSpdGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4P
Plasmid#104511PurposeUsed to evaluate the expression output of Saccharomyces pastorianus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSptGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pGSKU
Plasmid#72243PurposeContains the CORE cassette with convergent KlURA3 and KanMX4 markers and the I-SceI gene under the inducible GAL1 promoterDepositorInsertsKlURA3
kanMX4
I-SceI
ExpressionBacterialAvailable SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGSHU
Plasmid#72244PurposeContains the CORE cassette with convergent KlURA3 and hyg markers and the I-SceI gene under the inducible GAL1 promoterDepositorInsertsKlURA3
hyg
I-SceI
ExpressionBacterialAvailable SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Lifeact-tdTomato
Plasmid#64048PurposeFluorescent reporter for F-actin labeling in living cellsDepositorInsertLifeact
UseLentiviralTagstdTomatoExpressionMammalianPromoterUbiquitinAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
PMXS-NDI1
Plasmid#72876Purposeexpresses NDI1 in mammalian cellsDepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS4333 yeTadA1.0-T7 RNAP
Plasmid#137735PurposepCS4333 CEN/ARS vector, PGAL1-yeTadA1.0-100AA linker-T7 RNAP-TCYC1, TRP1 selectable markerDepositorInsertyeTadA1.0-T7 RNAP
ExpressionBacterial and YeastMutationE366G (See depositor comment below)Available SinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEIGW roGFP2-Orp1
Plasmid#64993PurposeMammalian expression of cytosolic roGFP2-Orp1 (lentiviral vector)DepositorAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET296-YcpLac111 CYC1p-MCP-NLS-2xyeGFP
Plasmid#104394PurposeYeast MCP-GFP expressionDepositorInsertMCP-NLS-2xyeGFP
ExpressionBacterial and YeastMutationMCP fused to NLS(SV40) and 2x yeast codon optimiz…PromoterCYC1Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLifeAct-miRFP703
Plasmid#79993PurposeF-Actin labeling with near-infrared fluorescent protein miRFP703DepositorInsertLifeact
TagsmiRFP703ExpressionMammalianPromoterCMVAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDS221
Plasmid#34981PurposeExpresses a high-affinity ePDZ variant fused to mCherry in yeast. Illumination with 440 nm light induces binding to LOVpep.DepositorInsertePDZb1–mCherry
ExpressionYeastPromoterTEFAvailable SinceMarch 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pYES2-HTH-HHT2
Plasmid#86482Purposeyeast expression of HHT2 with His10-TEV-HA tagDepositorAvailable SinceJan. 27, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pICH-roGFP2-ORP1
Plasmid#191677PurposeTi plasmid pICH86988 harbouring roGFP2-ORP1 for peroxide detection in plant cells.DepositorInsertredox(ro)GFP2-ORP1
UseBinary agrobacterium ti plasmidExpressionPlantPromoterCaMV 35SAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
S3_001_026_MV2
Plasmid#134422PurposepYTKMV2-pTDH3_NLS_FdeR-N_tPGK1-pGPM1-fdeO_mcherry_tTDH1DepositorInsertsmCherry
NLS_FdeR-N
TagsnoneExpressionYeastMutationnonePromoterpGMP1 and pTDH3Available SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
UG75-PAH1-3HA
Plasmid#184761PurposePAH1 overexpression. Promotes the formation of diacylglycerol from phosphatidate. Uses antibiotic resistance marker hphMX6.DepositorAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-flpE-puro
Plasmid#20733PurposeMammalian expression of FLPe recombinase from the highly-expressed CAGGS promoter; puro selectable markerDepositorInsertFLPe recombinase
UseFlp/frtExpressionMammalianPromoterCAGGSAvailable SinceMarch 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCfB2312 (TEF1p-Cas9-CYC1t_kanMX)
Plasmid#83946PurposeCas9-carrying vector with kanMX markerDepositorInsertCas9
ExpressionYeastAvailable SinceOct. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPMVAu8
Plasmid#98297PurposeEnhancing the upper-part mevalonate pathway; overexpressing codon-optimized Enterococcus faecalis mevalonate pathway genes under the control of consitutive promoters.DepositorInsertPRPL4A-EfmvaS-TEFM1-PRPL15A-EfmvaE -TEBS1
ExpressionYeastAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPCX roGFP2-Orp1
Plasmid#64991PurposeMammalian expression of cytosolic roGFP2-Orp1 (retroviral vector)DepositorAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-RNAPII-CTD wt #14-HA
Plasmid#160688PurposeExpression of GST-RNA Polymerase II C-terminal domain fusion protein. Contains 14 of the consensus heptapeptide repeats shown to be phosphorylated by Cdc2 kinase.DepositorInsertRNA Polymerase II CTD
ExpressionBacterialMutationC terminal domain onlyAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
UG75-DGK1-3HA
Plasmid#184759PurposeDGK1 overexpression. Promotes the formation of phosphatidate from diacylglycerol. Uses antibiotic resistance marker hphMX6.DepositorAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYSD085
Plasmid#212922PurposeEncodes the HA-tagged 649 Stalk yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsert649 Stalk
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
UAS:Zebrabow-B
Plasmid#118216PurposeFor broad gal4 inducible expression of Brainbow in zebrafishDepositorInsertBrainbow 1.0 L
UseZebrafish expressionAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHACK-GAL4>QF2(newHA1)
Plasmid#104873PurposeHACK Donor plasmids for converting GAL4 lines to QF2 lines using HACK method. Updated version of Addgene#80275 for easier cloning of insertsDepositorInsertT2A-QF2
UseCRISPRExpressionInsectAvailable SinceMarch 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pME-QFGal4-SV40pA
Plasmid#155118PurposeMiddle entry vector containing QFGal4DepositorInsertQFGal4
UseGateway middle entry vectorAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbA5c-MevT(CO)-T1-MBIS(CO, ispA)
Plasmid#35152DepositorInsertAtoB(co)-HMGS(co)-HMGR(co)-pTrc-MK(co)-PMK(co)-PMD-Idi-IspA
UseSynthetic BiologyExpressionBacterialMutationR364S in Mevalonate KinasePromoterLacUV5, pTrcAvailable SinceMay 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSems LifeAct-StayGold
Plasmid#222947PurposeExpression of LifeAct tagged with StayGold in mammalian cellsDepositorInsertLifeAct
TagsStayGoldExpressionMammalianPromoterCMVAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLPCX mito roGFP2-Orp1
Plasmid#64992PurposeMammalian expression of mitochondrial roGFP2-Orp1 (retroviral vector)DepositorInsertOrp1 (HYR1 Budding Yeast)
UseRetroviralTagsroGFP2ExpressionMammalianMutationmitochondrial targeting sequenceAvailable SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pScPPX2
Plasmid#112877PurposeExpresses His-tagged yeast exopolyphosphatase for purification from E. coliDepositorAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKMV-VioD
Plasmid#65350Purposesysthesis of vioD gene in the violacein pathwayDepositorInsertvioD
UseSynthetic BiologyAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
mito-mScarlet
Plasmid#141153PurposeFluorescent labeling of the mitochondrial matrix in mammalian cellsDepositorAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-AKAR4-Kras
Plasmid#61621PurposeNon-raft/plasma membrane-targeted FRET biosensor for monitoring PKA activityDepositorInsertAKAR4-Kras
TagsC-terminal targeting sequence from Kras, Cerulean…ExpressionMammalianPromoterCMVAvailable SinceMarch 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKMV-VioC
Plasmid#65349Purposesysthesis of vioC gene in the violacein pathwayDepositorInsertvioC
UseSynthetic BiologyAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV151
Plasmid#226180PurposeExpresses Cas9 in a backbone compatible with K. phaffii.DepositorInsertCas9
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterGAP1Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
tubP-FRT>GAL80-6-FRT>
Plasmid#63173Purposeubiquitous expression of a "flp-Out" Drosophila codon-optimized GAL80 gene cassetteDepositorInsert"Flp-Out" GAL80
ExpressionInsectAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMC8b-XI3up
Plasmid#176170Purposeyeast MoClo level-0 part plasmid type 8b containing 5' homology for integration site XI-3DepositorInsert5' homology for integration site XI-3
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only