We narrowed to 2,337 results for: TUB
-
Plasmid#91489PurposeProtein expression and purification of human SH3 domain construct DNMBP-6/6DepositorInsertDNMBP-6/6 (DNMBP Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Clover-MAPTau-C-10
Plasmid#56371PurposeLocalization: Microtubules, Excitation: 505, Emission: 515DepositorAvailable SinceDec. 5, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-Solo-mScarlet-MAPRE1
Plasmid#227323PurposeDonor template for mScarlet insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mScarlet Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-MAP4
Plasmid#227296PurposeDonor template for mStayGold insertion into the N-terminus of the MAP4 locus. For microtubule visualization. To be co-transfected with sgRNAplasmid px330-PITCh-MAP4 (Addgene #227295)DepositorInsertMAP4 Homology Arms flanking a mStayGold Tag (MAP4 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 LC3B G120A no-stop
Plasmid#123206PurposeGateway entry clone encoding human MAP1LC3B G120A lacking stop codon, suitable for C-terminal taggingDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseGateway entry vector / entry cloneMutationGlycine 120 to Alanine, stop codon removedAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DNMBP-5/6
Plasmid#91474PurposeProtein expression and purification of human SH3 domain construct DNMBP-5/6DepositorInsertDNMBP-5/6 (DNMBP Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DNMBP-2/6
Plasmid#91422PurposeProtein expression and purification of human SH3 domain construct DNMBP-2/6DepositorInsertDNMBP-2/6 (DNMBP Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DNMBP-4/6
Plasmid#91375PurposeProtein expression and purification of human SH3 domain construct DNMBP-4/6DepositorInsertDNMBP-4/6 (DNMBP Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DNMBP-3/6
Plasmid#91277PurposeProtein expression and purification of human SH3 domain construct DNMBP-3/6DepositorInsertDNMBP-3/6 (DNMBP Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DNMBP-1/6
Plasmid#91276PurposeProtein expression and purification of human SH3 domain construct DNMBP-1/6DepositorInsertDNMBP-1/6 (DNMBP Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LC3-RFP-LC3ΔG
Plasmid#168997PurposeExpresses GFP-LC3-RFP-LC3ΔG in mammalian cells and zebrafish to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
TagsEGFP and mRFP1ExpressionMammalianAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau P301L
Plasmid#46908Purposeexpresses EGFP tagged Tau P301L in mammalian cellsDepositorAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-GFP-LC3-RFP
Plasmid#84573PurposeExpresses GFP-LC3-RFP in mammalian cells to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseRetroviralTagsEGFP and mRFP1ExpressionMammalianAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B G120A
Plasmid#123235PurposeExpresses mCherry-EGFP-LC3B G120A in mammalian cells. Negative control for tandem reporter. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28-his-3C_Tau352
Plasmid#100092PurposeExpresses human full-length fetal tau protein with the N-terminal 3C-cleavable His6 tagDepositorInsertFetal microtubule-associated protein tau (MAPT Human)
TagsHis6ExpressionBacterialMutationwild type sequencePromoterT7Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-mScarlet-MAP4-MTBD
Plasmid#171488PurposeT7 promotor drives in vitro transcription of mScarlet-tagged mouse MAP4-Microtubule Binding Domain mRNADepositorAvailable SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-miRFP-MAP4-MTBD
Plasmid#171487PurposeT7 promotor drives in vitro transcription of miRFP-tagged mouse MAP4-Microtubule Binding Domain mRNADepositorAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-LC3B G120
Plasmid#123241PurposeExpression vector with PGK promoter for low expression of EGFP-LC3B G120. For lentivirus production and stable transduction in mammalian cells.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseLentiviralTagsEGFPExpressionMammalianMutationDeleted amino acids 121-125. Stop codon after G12…PromoterPGKAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only