We narrowed to 10,106 results for: UTY
-
Plasmid#223166Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Allosteric Domain
Plasmid#169835PurposeExpresses C-terminal flag-tagged CAD with substitution of allosteric domain F1308 - C1455 with a (GGGS)X3 linkerDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationSubstitution of amino acids F1308 - C1455 with a …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCRbluntII-pHES7-STOPgRNA
Plasmid#204349PurposegRNA to target pig HES7 stop codonDepositorInsertPig HES7-STOP-gRNA (HES7 Sus domesticus (pig))
ExpressionMammalianAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(FCA)-6xHis-NLS(SV40)
Plasmid#185701PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(FCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-6xHis-NLS(SV40)
Plasmid#185703PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(SCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-6xHis-NLS(SV40)
Plasmid#185704PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(BCA)-6xHis-NLS(SV40)
Plasmid#185702PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(BCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_NLuc_FRT-PuroR
Plasmid#177865PurposeCloning Backbone for NanoLuc-luciferase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertNLuc-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_BSD_FRT-PuroR
Plasmid#177867PurposeCloning Backbone for Blasticidin-S-deaminase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertBSD-based EXSISERS
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsOLLASExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_SurfaceHaloTag_FRT-PuroR
Plasmid#177869PurposeCloning Backbone for Surface-HaloTag-based EXSISERS containing FRT-sites flanked PuroR cassette; clone homology arms via BbsI (or BpiI).DepositorInsertSurface-HaloTag-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Cstem-Tac(5A)
Plasmid#162497PurposeExpresses GFP tagged Tac mutant in mammalian cells. The five O-glycosylation sites in the stem region are mutated, and the stem region of CD8a is inserted between GFP and Tac(5A).DepositorTagsGFPExpressionMammalianMutationThe five threonine residues are mutated into alan…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 rtTA BirA eIF4G +MIC
Plasmid#158790PurposepcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 including the microexon for generation of N2A FlpIn cell lines for BioIDDepositorInserteIF4G1 (with microexon)
Tags3xFlag and BirA*ExpressionMammalianPromoterminiCMVAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1132
Plasmid#29053PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP/Cre fusion reporterDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V/D38A-IRES-mVenus
Plasmid#236077PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and a double mutant NRAS (NRASG12VD38A).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12V D38APromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V-IRES-mVenus
Plasmid#236076PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-mVenus-P2A-NRASG12V
Plasmid#236072PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166D
Plasmid#226720PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166DDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166L
Plasmid#226721PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166LDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-D195A
Plasmid#226722PurposeMammalian expression of cytosolic mouse CNDP2 mutant D195ADepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-H445F
Plasmid#226723PurposeMammalian expression of cytosolic mouse CNDP2 mutant H445FDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterUbcAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterPGKAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
RB1-TP53-LRG-GFP
Plasmid#225876PurposeGuides targeting TP53 and RB1DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX401-INK4A
Plasmid#121919PurposeDoxycycline-inducible expression of p16-INK4A product of CDKN2ADepositorAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFC34K LgBiT TK-Neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229770PurposeHuman Col4A5 tagged at C-terminal with LgBiT to be used with C-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC36K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229769PurposeHuman Col4A3 tagged at C-terminal with SmBiT to be used with C-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
G13-CASE
Plasmid#168127PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G13. Composed of the subunits G alpha 13 (GNA13) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at F125/D126 within GNA13Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gq-CASE
Plasmid#168125PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gq. Composed of the subunits G alpha q (GNAQ) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at F124/E125 within GNAQAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi3-CASE
Plasmid#168122PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi3. Composed of the subunits G alpha i3 (GNAI3) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A114/E115 within GNAI1Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
G15-CASE
Plasmid#168126PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G15. Composed of the subunits G alpha 15 (GNA15) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at E244/N245 within GNA15Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-mScarletI
Plasmid#217783PurposeExpresses CRISPRoff-mScarletI (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-mScarletI-KRAB) downstream of the CAG promoter for gene epigenetic silencingDepositorInsertCRISPRoff-mScarletI (DNMT3A-DNMT3L-dCas9-mScarletI-KRAB)
Tags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and mScarletIExpressionMammalianPromoterCAGAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gi1-CASE
Plasmid#168120PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi1. Composed of the subunits G alpha i1 (GNAI1) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A121/E122 within GNAI1Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi2-CASE
Plasmid#168121PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi2. Composed of the subunits G alpha i2 (GNAI2) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at C112/E115 within GNAI2Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFUW-VenusFlag-hCD44
Plasmid#211824PurposeExpress CD44 in mammalian cellsDepositorInsertCD44 (CD44 Human)
UseLentiviralTagsN-Terminal Venus and Flag tagsExpressionMammalianMutationisoform corresponds to UniProt ID P16070-1 with a…Available SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_hACE2_HygR
Plasmid#155296PurposeLentiviral vector to generate hACE2 stable expressing cell line, Hygromycin resistanceDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEX-4T1 human PP2A Aα full length
Plasmid#132634Purposeexpresses human PP2A Aα full length in E. coliDepositorInsertPP2A Aα (PPP2R1A Human)
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDMJ2-SARS-CoV-2-Spike (EG.5)
Plasmid#241114PurposeExpresses SARS-CoV-2 spike (EG.5) protein for creating pseudotyped virusDepositorInsertSpike (EG.5) (S SARS-CoV-2)
ExpressionMammalianMutationT19I, L24del, P25del, P26del, A27S, V83A, G142D, …Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 762 (pCS2-EGFP-hsKRAS4B-G12V)
Plasmid#156407PurposepCS2 CMV expression vector driving EGFP fused human KRAS4B-G12VDepositorInserthuman mutant KRAS4B-G12V (KRAS Human)
TagsEGFPExpressionMammalianMutationmutant KRAS4B-G12VPromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE_FKBP-mEGFP-WIPI2d_P2A-FRB-Fis1 (no mt-mKeima)
Plasmid#223794PurposeStable expression of protein in mammalian cell cultureDepositorAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 human PP2A B56α full length
Plasmid#132635Purposeexpresses human PP2A B56α full length in E. coliDepositorInsertPP2A B56α
ExpressionBacterialAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDRM55 tet-AR(1-707)
Plasmid#183503PurposeLentiviral vector expressing a doxycycline-inducible constitutively active truncated androgen receptor (wild type AR)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralExpressionMammalianMutationConstitutively active truncated AR; spans AR 1-70…PromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-A
Plasmid#200824PurposeAAV transfer plasmid encoding a circularized RNA barcode A under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianPromoterhSynAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_mGreenLantern_FRT-PuroR-HSV-TK
Plasmid#177868PurposeCloning Backbone for mGreenLantern-based EXSISERS containing FRT-sites flanked PuroR-HSV-TK cassette; clone homology arms via BbsI (or BpiI).DepositorInsertmGreenLantern-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKT2-ACVR1-G328V-IRES-Katushka
Plasmid#135002PurposeExpresses ACVR1 with a G328V mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertActivin A receptor, type I (ACVR1) G328V (ACVR1 Human)
ExpressionMammalianMutationc.983G>T, p.G328VAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFN33K LgBiT TK-neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229768PurposeHuman Col4A5 tagged at N-terminal with LgBiT to be used with N-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEx-iSeroSnFR-EnhancedExport
Plasmid#129180PurposeFluorescent reporter for serotonin imaging (conditional + membrane localization tag with enhanced export sequence)DepositorInsertiSeroSnFR
UseAAVTagsIg-kappa leader, Myc, and PDGFR + enhanced ER exp…PromoterCAGAvailable SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFN35K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229767PurposeHuman Col4A3 tagged at N-terminal with SmBiT to be used with N-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 3 chain (COL4A3) (COL4A3 Human)
UseLuciferaseTagsSmBiTMutationSee Depositor CommentsAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only