We narrowed to 13,994 results for: eng
-
Plasmid#59923PurposeExpression vector for Rabies virus SAD B19 matrix protein geneDepositorInsertRabies virus matrix protein
ExpressionMammalianPromoterCAGAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
RCAS(A) mdnTcf4Ben (CT#1130)
Plasmid#14020DepositorInsertTcf4B (Tcf7l2 Mouse)
UseRetroviral; Avian expressionMutationDominant negative Tcf4B, engrailed fusionAvailable SinceFeb. 16, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET30-RT1306
Plasmid#131521PurposeExpresses engineered RT-1306 with His-tagDepositorInsertRT-1306
TagsHis-tagExpressionBacterialPromoterT7Available SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-cyto-Ruby3-iATPSnFR1.0
Plasmid#102554Purposeexpresses cytoplasmic ATP sensor in astrocytes with red reference proteinDepositorInsertmRuby3-iATPSnFR1.0
UseAAVAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-KIF1B beta-FL
Plasmid#79108PurposeMammalian expression of GFP-KIF1B beta-FLDepositorInsertGFP-KIF1B beta full length (KIF1B Human)
TagsGFPExpressionMammalianMutationexon 25 missing (natural splice varient)PromoterCMVAvailable SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-dCas9-ZIM3-KRAB-BFP
Plasmid#196712PurposeCRISPR-inhibition. dCas9-KRAB(ZIM3) with TagBFP for sorting. Improved KRAB domain from ZIM3DepositorInsertdCas9-KRAB(ZIM3)-T2A-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSMutationD10A, N863APromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-Puro
Plasmid#117686PurposeThe plasmids pSpCas9 (BB)-2A-Puro (Addgene, #48139) and eSpCas9 (1.1) (Addgene, #71814) were combined to express both “enhanced specificity” Cas9 and puromycin resistance protein.DepositorInserteSpCas9(1.1)
UseCRISPRTagsPuroR (R166H)ExpressionMammalianMutationK848A, K1003A, R1060APromoterU6Available SinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
SlugCas9-HF
Plasmid#163796PurposeExpresses highly specific SlugCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianMutationSlugCas9 (R247A, N415A, T421A, R656A)Available SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_D17
Plasmid#84611PurposeIntroduces DSB at D17 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJG/ Inducible ALPHA MHC
Plasmid#55792Purposetransgene expression driven by inducible ALPHA MHC promoterDepositorTypeEmpty backboneExpressionMammalianPromoterInducible ALPHA MHCAvailable SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIDS-LSD1fl
Plasmid#109157PurposeEncodes human full-length LSD1 to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length LSD1, sequence-optimized for insect cells (KDM1A Human)
ExpressionInsectPromoterp10Available SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
PT2/C-fluc
Plasmid#20203DepositorInsertC-Fluc
UseTransposonAvailable SinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-OCT4-t2a-KLF4-e2a-SOX2-17-IRES-GLIS1
Plasmid#193356PurposeVEE-OKS*iG (self-replicating RNA vector expressing human OCT4 + KLF4 + super-SOX + GLIS1 + PuroR) for generation of integration-free iPSCsDepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianMutationSOX2-17 is engineered highly cooperative chimeric…Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human SHIP2
Plasmid#124645PurposeExpresses HIS tagged human SHIP2 in COS-7/HEK cellsDepositorInsertINPPL1 (INPPL1 Human)
TagsHis Xpress (N-terminal)ExpressionMammalianMutationcoding sequence starts at amino acid 18 as calcul…Available SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMMB67EH-YFP
Plasmid#90104PurposeYFP control expression plasmidDepositorInsertYFP
UseBroad-host rangeExpressionBacterialPromoterPtacAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0000
Plasmid#90997PurposeModule A, Promoter: none, Gene: none, Terminator: noneDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pN7-S15
Plasmid#190665PurposeExpresses N7 ribosomal protein S15DepositorInserthuman codon optimized N7 S15
ExpressionMammalianPromoterCMVAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CWB-pre-eGRASP(p30)
Plasmid#111597PurposeAn AAV vector that expresses green pre-eGRASP(p30) under the CaMKIIa promoter.DepositorInsertgreen pre-eGRASP(p30)
UseAAVPromoterCaMKIIaAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHD_v2
Plasmid#32183DepositorInsertTALE Monomer HD
ExpressionBacterialAvailable SinceOct. 6, 2011AvailabilityAcademic Institutions and Nonprofits only