We narrowed to 5,952 results for: crispr cas9 expression plasmids
-
Plasmid#149424PurposeThe piggyBac plasmid harboring Hsp70Bb-Cas9-T2A-eGFP-p10 and Opie2-dsRed-SV10 (marker gene)DepositorInsertCas9
UseCRISPRTagseGFPExpressionInsectPromoterDmel Hsp70BbAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC2_2_dCas9_VP64_sgRNA
Plasmid#163707PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VP64 activation domainDepositorInsertsdCas9
VP64+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adrb1
Plasmid#184294PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adrb1DepositorInsertsgRNA-Adrb1
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adra1b
Plasmid#184293PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adra1bDepositorInsertssgRNA-Adra1b
sgRNA-Adra1b
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Grp
Plasmid#184292PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting GrpDepositorInsertsgRNA-Grp
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Oprl1
Plasmid#184291PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Oprl1DepositorInsertsgRNA-Oprl1
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Rxfp3
Plasmid#184290PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Rxfp3DepositorInsertsgRNA-Rxfp3
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adrb1
Plasmid#184295PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adrb1DepositorInsertsgRNA-Adrb1
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgHtr2c (mouse/rat)
Plasmid#249541PurposeCre-dependent editing of Htr2c with SaCas9DepositorAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Cas9-gRNA-TagBFP2
Plasmid#124774Purpose3rd generation lentiviral plasmid encoding Cas9, TagBFP2, and a gRNA backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1195-pssAAV.U1a.hNme2Cas9
Plasmid#129534PurposeAAV vector expressing Nme2Cas9DepositorInserthuman codon-optimized Nme2Cas9
UseAAVTags2xNLS and NLS-3xHA-NLSPromoterU1aAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_KanR neo
Plasmid#167893PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorInsertCas9-VPR
UseCRISPRAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9 fused to scFv (anti-spike)
Plasmid#186421PurposeExpression of dCas9 with C-terminal nanobody fusion recognizing spike protein from SARS-CoV-2DepositorInsertdCas9-scFv fusion (anti-SARS-CoV-2 spike)
UseCRISPRTags6HisAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-J23111
Plasmid#113149PurposePlasmid constitutively expressing dCas9 proteinDepositorInsertdCas9
ExpressionBacterialMutationD10A & H840AAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_hROSA26_Left
Plasmid#191442PurposeExpresses the hROSA26 left sgRNA in combination with FLAGless eSpCas9(1.1) to target the hRosa26 safe harbor locusDepositorInserthROSA26 sgRNA
UseCRISPRExpressionMammalianPromoterCBhAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SETD2(SET)-Cas9
Plasmid#186700PurposePlasmid encoding SETD2-Cas9 fusion under CMV promoterDepositorInsertSETD2(SET)-Cas9
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-spCas9-WPRE-miR124T
Plasmid#245071PurposeCRISPR Editing with SpCas9, with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertCas9, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Cas9_puro
Plasmid#108100PurposeLentiviral expression plasmid of spCas9 with puromycin resistance geneDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS promoterAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-NED
Plasmid#109358PurposeMammalian vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPRTagsdCas9, SV40 NLS, 3xFLAGExpressionMammalianPromoterCMVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9FL-P2A-turboGFP
Plasmid#80941PurposePlasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP.DepositorInsertCas9FL
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9C-P2A-turboGFP
Plasmid#80935PurposePlasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP.DepositorInsertCas9C
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHiFi Cas9-2×sgRNA (empty, donor)
Plasmid#162277PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.DepositorInsertHiFi Cas9
UseCRISPRTagsBPNLS and FLAG tagExpressionMammalianMutationSpCas9 (R691A)Available SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only