We narrowed to 13,948 results for: CRISPR-Cas9
-
Plasmid#202084PurposeFrame -2 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame –2 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDD425
Plasmid#202078PurposeFrame +0 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame +0 sgRNA
UseCRISPRPromoterEF1aAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB33
Plasmid#158151PurposeConstruction of inPTG-Cas9 plasmids expressing gRNA within an engineered intron for binary vector plant genome editing.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-TREX2-N
Plasmid#244022PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-AtEXO1B-N
Plasmid#244023PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCPH3.3-GS3
Plasmid#204764PurposeExpression of Cas9 and human H3.3DepositorInsertH3.3
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_1
Plasmid#72371PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_2
Plasmid#72372PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPATZ1.1.0-gDNA
Plasmid#132476PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPATZ1 (PATZ1 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF449-R.1.0-gDNA
Plasmid#132469PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF449 (ZNF449 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF302.1.0-gDNA
Plasmid#132467PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF302 (ZNF302 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF253.1.0-gDNA
Plasmid#132461PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF253 (ZNF253 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZFPM2.1.0-gDNA
Plasmid#132459PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZFPM2 (ZFPM2 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF3.1.0-gDNA
Plasmid#132440PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSHZ1.1.0-gDNA
Plasmid#132434PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTSHZ1 (TSHZ1 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_PBX2_1
Plasmid#72357PurposeEncodes gRNA for 3' target of human PBX2 along with Cas9 with 2A GFPDepositorInsertPBX2 (PBX2 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_PBX2_2
Plasmid#72358PurposeEncodes gRNA for 3' target of human PBX2 along with Cas9 with 2A GFPDepositorInsertPBX2 (PBX2 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.sgRNA.EFS.GFP
Plasmid#57822Purpose3rd generation lentiviral Vector for Sp sgRNA delivery without SpCas9, GFP, EFS Promoter drivenDepositorInsertssgRNA
EFS
eGFP
UseCRISPR and LentiviralAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQ153
Plasmid#69304PurposeGateway entry vector with pco-dCas9-3X(SRDX)DepositorInsertpco-dCas9-3X(SRDX) (Plant codon-optimized)
UseCRISPRTags2XFLAGMutationSRDX (X3) repressor fusion; NLS fusionAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ152
Plasmid#69303PurposeGateway entry vector with pco-dCas9-VP64DepositorInsertpco-dCas9-VP64 (Plant codon-optimized)
UseCRISPRMutationVP64 activator fusion; NLS fusionAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
DYNLL2 A10.5 gRNA
Plasmid#90663Purpose3rd generation lentiviral gRNA plasmid targeting human DYNLL2DepositorInsertDYNLL2 (Guide Designation A10.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX552
Plasmid#60958PurposepAAV-U6sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and nuclei.DepositorInsertsU6_(SpaI)_sgRNA
Syn_EGFP-KASH
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterSynapsin and U6Available SinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.sgRNA.EFS.tRFP
Plasmid#57823Purpose3rd generation Lentiviral Vector for Sp sgRNA delivery without SpCas9, tagRFP, EFS Promoter drivenDepositorInsertssgRNA
EFS
tagRFP
UseCRISPR and LentiviralAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO5.sgRNA.EFS.tRFP657
Plasmid#57824PurposeLentiviral Vector for Sp sgRNA delivery without SpCas9, tagRFP657, EFS Promoter drivenDepositorInsertssgRNA
EFS
tagRFP657
UseCRISPR and LentiviralAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgRNA expression vector
Plasmid#51132PurposeFor in vitro transcription of sgRNA from the T7 promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterT7Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
VCP F12.4 gRNA
Plasmid#90939Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F12.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
VCP F11.4 gRNA
Plasmid#90938Purpose3rd generation lentiviral gRNA plasmid targeting human VCPDepositorInsertVCP (Guide Designation F11.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
CLTC G9.4 gRNA
Plasmid#90634Purpose3rd generation lentiviral gRNA plasmid targeting human CLTCDepositorInsertCLTC (Guide Designation G9.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 1 GAPDH
Plasmid#83808PurposeExpress Sg-1 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 16x(MS2) MUC4.1
Plasmid#101154PurposegRNA with 16 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F2.3 gRNA
Plasmid#90653Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F2.3)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
BRCA1 A10.2 gRNA
Plasmid#90549Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A10.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA2 A11.2 gRNA
Plasmid#90550Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2DepositorInsertBRCA2 (Guide Designation A11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
FOXM1 C11.2 gRNA
Plasmid#90690Purpose3rd generation lentiviral gRNA plasmid targeting human FOXM1DepositorInsertFOXM1 (Guide Designation C11.2)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only