We narrowed to 7,565 results for: tet on
-
Plasmid#211466PurposeLentivirus backbone expressing mCherry and GFP1-10 fusion protein with a mitochondrial localization signalDepositorInsertmito-mCherry-GFP1-10
UseLentiviralExpressionMammalianPromoterEF-1aAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFU-AgaIVA-VG
Plasmid#24145DepositorInsertVenus-AgatoxinIVA-FLAG-GPI anchor
UseLentiviralExpressionMammalianAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJBL701
Plasmid#140371PurposeExpresses TetR protein under the control of T7-lacO promoterDepositorInsertT7-lacO-TetR-T
Tags6XHisExpressionBacterialAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECRETS-A
Plasmid#196986PurposeFor SECRETS protocol to screen for gRNA activity and specificity: bacterial expression Cas9 in the presence of anhydrotetracycline (aTc).DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpltetO1Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRosa26 R1-ccdB-R2 RexNeo PI-SceI
Plasmid#24418DepositorInsert
UseMouse TargetingAvailable SinceMarch 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBL4
Plasmid#50548PurposeExpresses CcaS and CcaR constitutively, and sfGFP/TetR under the PcpcG2 promoterDepositorInsertsCcaS
CcaR
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCL66-decoder
Plasmid#159453PurposeInsert: Pfus1mut-tetR-nls-malE-tCyc1. Same insert as pCL33-decoder in a multiple integration shuttle vector. Backbone: pRG235 (addgene). Marker: Leu2.DepositorInsertPfus1mut-tetR-nls-malE-tCyc1
UseSynthetic BiologyExpressionYeastPromoterPfus1mutAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDB007ns2a
Plasmid#99214PurposeAccessory plasmid for PACE of PylRS variants; negative selectionDepositorInsertPpsp [SD8] gIII; PproK tyrT(Opt,CUA); Ptet [SD4] T7RNAP(S12*,S203*)
Mutationamber codons at positions 12 and 203 of T7 RNA po…PromoterPpsp, PproK, and PtetAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUHD-AID
Plasmid#121066Purposevector expresses AID-fusion protein under TRE promoter and with puromycin resistance selectionDepositorTypeEmpty backboneTagsAIDExpressionMammalianPromoterTREAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAJM.717
Plasmid#108517PurposePTet*-YFP Reporter. aTc sensor for use in Marionette strain.DepositorInsertPTet*-YFP
ExpressionBacterialAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMrfp
Plasmid#59773PurposeDerived from pCM62; ampR, tetR, PBAD - rfpDepositorInsertrfp
ExpressionBacterialPromoterpBADAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRS306-PTDH3-SUMO10-6SIM
Plasmid#190248PurposeExpression SUMO10-SIM6 in yeast cellsDepositorInsert10SUMO-6SIM
ExpressionYeastAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pREVTRE-AID
Plasmid#121067PurposeRetrovirus vector expresses AID-fusion protein under TRE promoter and with hygromycin resistance selectioDepositorTypeEmpty backboneUseRetroviralTagsAIDExpressionMammalianPromoterTREAvailable SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALS3-Ma-SUMO-sfGFP-WT
Plasmid#212122PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses SUMO-sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.DepositorInsertsSUMO-sfGFP-WT
M. alvus Pyl-tRNA(6)
TagsHis6 and SUMOExpressionBacterialPromoteraraC and lppAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKS014
Plasmid#65467PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) Ntag and beta-galactosidaseDepositorInsertNtag-beta galactosidase
UseSynthetic BiologyTagsFLAGExpressionBacterialPromoterpl-TetOAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFGL1258
Plasmid#116898PurposeTetOFF:GFP:CenpA (centromere marker)DepositorInsertsCenpA promoter region
CenpA
UseFungal expression (in magnaporthe oryzae)Available SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKS011
Plasmid#65464PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) MBP (Maltose Binding Protein), Ntag, and mCherryDepositorInsertMBP-Ntag-mCherry
TagsFLAG and MBPExpressionBacterialPromoterpl-TetOAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDB1751
Plasmid#174013PurposepDUAL plasmid expressing GFP from 41nmt1 promoterDepositorInsertGFP
TagsGFPExpressionYeastPromoter41nmt1 and 41nmt1 promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKS012
Plasmid#65465PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) Ntag and mCherryDepositorInsertNtag-mCherry
UseSynthetic BiologyTagsFLAGExpressionBacterialPromoterpl-TetOAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMGT1
Plasmid#109404PurposeTetracycline resistance reporter of ChnR activationDepositorInsertTetracycline resistance reporter of ChnR activation
ExpressionBacterialAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
circRAJ31-Toehold_mutant
Plasmid#69930PurposeExpresses a toehold mutant of the circRAJ31 riboregulator encased in a permuted intron exon ribozyme, which circularises the riboregulator. This mutant does not activate cisRAJ31.DepositorInsertplTet-circRAJ31_toeholdmutant
UseSynthetic BiologyMutation4 bases mutated in toehold of riboregulatorPromoterPltetO1-2Available SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNVL-pvdIJD
Plasmid#169872PurposeIntegration vector for deleting pvdIJD locus in P. putidaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC.RNe.TYB1.a1-400.wt
Plasmid#17949DepositorInsertEscherichia coli RNase E residues 1-400
Tagsintein-chitin binding domainExpressionBacterialMutationresidues 1-400Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
EC.RNe.TYB1.a1-395.wt
Plasmid#17950DepositorInsertEscherichia coli RNase E residues 1-395
Tagsintein-chitin binding domainExpressionBacterialMutationresidues 1-395Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJAK081
Plasmid#245144PurposeKnock-in plasmid for insertion of DNA sequences between CD0188 (pyrE) and CD0189 in the C. difficile R20291 genome.DepositorInsertPtet-mreB2
UseBacterial knock-inPromoterPtetAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH2B
Plasmid#241996PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-2-shH2A
Plasmid#241997PurposeSleeping Beauty vector for inducible expression of a chicken H2A targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2A
ExpressionMammalianAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-1-shH2B
Plasmid#240417PurposeSleeping Beauty vector for inducible expression of a chicken H2B targeting shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorInsertH2B
ExpressionMammalianPromoterTREAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only