We narrowed to 8,732 results for: sgrna
-
Plasmid#138135PurposeTargeted simultaneous C-to-T and A-to-G in riceDepositorInsertAPOBEC3A-wtTadA-TadA7.10-nCas9-UGI-NLS
ExpressionPlantAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-1
Plasmid#86924PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-2
Plasmid#86925PurposeTo express sgRNA target HUWE1 geneDepositorAvailable SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with U6 promoter
Plasmid#48962Purposeto drive the sgRNA expression under a U6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pH-PABE-7-sgRNA
Plasmid#115621PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_nsgRNA(PP7)
Plasmid#232436PurposensgRNA for PE3b correction of the rd12 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuidPuro-hTP73_sgRNA-1
Plasmid#88855PurposeCRISPR KO of Trp73DepositorInsertTrp73
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA048_Grb10
Plasmid#232934PurposeExpression vector for a sgRNA against the mouse Grb10 locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Grb10 S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNAs-Crym
Plasmid#200067PurposeFor the knock down of Crym with an astrocyte specific mCherry expressionDepositorInsertU6-3xsgRNA-Crym
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryPromoterU6, GfaABC1DAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNAmreB
Plasmid#149654Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_Psyn-sgRNA500
Plasmid#149613PurposegRNA expression in B. burgdorferi, parental vectorDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuidPuro-hTP63_sgRNA-1
Plasmid#88854PurposeCRISPR KO of Trp63DepositorInsertTrp63
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only