We narrowed to 5,921 results for: crispr cas9 expression plasmids
-
Plasmid#113132PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 3 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA2
Plasmid#113131PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCasTet-λ
Plasmid#128318PurposeConstitutive expression of cas9 and anhydrotetracycline/tetracycline inducible expression of lamda RED. Useful variant of Plasmid #62225 when arabinose induction is not possible.DepositorInsertTetR and pTetR/TetO
UseCRISPR and Synthetic BiologyExpressionBacterialMutationConstitutive expression of cas9 and anhydro-tetra…Promotertet promoterAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK-puromycin
Plasmid#51133Purposeexpresses sgRNA from the U6 promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
sg1+sg2+sg3
Plasmid#113969PurposeTriple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg1+sg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
BB3nK_ext_AC
Plasmid#108686PurposePlasmid for assembly of donor DNA templates consisting of two expression unitsDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
BB3nK_ext_AD
Plasmid#108687PurposePlasmid for assembly of donor DNA templates consisting of three expression unitsDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCH
Plasmid#164160PurposeIncQ BHR plasmidDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CMV-SV40NLS-OgeuIscBE193A-3XHA
Plasmid#222861PurposeThis plasmid codes for the OgeuIscB nickaseDepositorInsertOgeuIscB Nickase
UseCRISPRTags3X HA and Nucleoplasmin NLS and ITR2ExpressionMammalianMutationE193A for nickase mutationPromoterCMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_502
Plasmid#96923Purposefor CRISPRa, lentiviral expression of gRNA scaffold using activator P65 HSFDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTJK459
Plasmid#138008PurposeEmpty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorTypeEmpty backboneUseLentiviralMutationU-A flip and hairpin extension: cgtttAagagctaTGCT…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMLS328
Plasmid#73717PurposeC. elegans germline CRE expression vectorDepositorInsert2xNLS-CRE
UseCre/LoxExpressionWormPromoterPeft-3Available SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAS_sfGFP150K
Plasmid#193313PurposepAS control plasmid for sfGFP expressionDepositorInsertsuper folder GFP
ExpressionMammalianMutation150K in sfGFPPromoterEF1Available SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKM197
Plasmid#132665PurposepyrE-targeted CRISPR-Cas9 control plasmid. Cas9 expression is controlled by the xylR promoter and results in improved conjugation efficiency. Induction with xylose results in a pyrE mutant.DepositorInsertUpstream & Downstream pyrE deletion region
UseE. coli - c. difficile shuttle vectorAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Stuffer
Plasmid#106248PurposeDestination vector for U6::gRNA expression cassetteDepositorTypeEmpty backboneUseAAVAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only