We narrowed to 8,877 results for: BLI;
-
Plasmid#206398PurposeExpresses four genes (human ePOU, SOX2, KLF4, c-MYC) in mammalian cells, for lentivirus generation.DepositorUseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-Flag-NSF/S647A
Plasmid#74938PurposeMammalian expression of human NSF mutant S647A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationS647A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-CYBC1:CYBB-SmBiT BiBiT Vector(CMV)
Plasmid#237084PurposeExpress LgBiT-CYBC1:CYBB-SmBiT Fusion Protein in Mammalian Cells under a CMV promoterDepositorUseTagsLgBiT and SmBiTExpressionMammalianMutationNonePromoterCMVAvailable sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET PD-1/SHP2 Bidirectional Vector
Plasmid#237016PurposeExpress NanoLuc(R)-PD1/SHP2-HaloTag Fusion Proteins in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector, NanoLuc-NRAS (Q61K)-CRAF RBD-HaloTag
Plasmid#236860PurposeExpress NanoLuc(R)-NRAS (Q61K)-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61KPromoterCMVAvailable sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoLuc-NRAS (Q61R)-CRAF RBD-HaloTag BiBRET Vector
Plasmid#236862PurposeExpress NanoLuc(R)-NRAS (Q61R)-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61RPromoterCMVAvailable sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector HaloTag-NRAS WT-BRAF RBD-NanoLuc
Plasmid#236851PurposeExpress HaloTag(R)-NRAS WT-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
BiBRET Vector HaloTag-NRAS (Q61R)-BRAF RBD-NanoLuc
Plasmid#236852PurposeExpress HaloTag(R)-NRAS (Q61R)-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61RPromoterCMVAvailable sinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV 9P31-hSyn-Venus-P2A-Tau-RING I18R/M72E
Plasmid#233694PurposeAAV expression of Venus-P2A-Tau-RING-I18R/M72E from hSyn promoterDepositorInsertVenus-P2A-Tau-RING I18R-M72E
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 C100A-WPRE-UbC-Emerald
Plasmid#225949PurposeLentiviral vector plasmid expressing human CKAP4 mutation C100A under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationC100APromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 CC-WPRE-UbC-Emerald
Plasmid#225950PurposeLentiviral vector plasmid expressing human CKAP4 mutation double cysteine (CC) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationAdditional cysteine inserted after Cys-100PromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(1-131)-WPRE-UbC-Emerald
Plasmid#225955PurposeLentiviral vector plasmid expressing human CKAP4 mutant lacking the luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationTruncated CKAP4 (1-131) lacking the luminal domainPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RTN4-WPRE-UbC-Emerald
Plasmid#225938PurposeLentiviral vector plasmid expressing human reticulon 4 (RTN4) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM2-WPRE-UbC-Emerald
Plasmid#225940PurposeLentiviral vector plasmid expressing human stromal interaction molecule 2 (STIM2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1
Plasmid#218156PurposeThis plasmid harbors the base editor SCBE3-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionTagsExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1-Hypa
Plasmid#218158PurposeThis plasmid harbors the base editor SCBE3-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionTagsExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-Hypa
Plasmid#218157PurposeThis plasmid harbors the base editor SCBE3-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionTagsExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable sinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Creb5 shRNA
Plasmid#195020PurposeBovine Creb5 shRNA targeting the Creb5 3′UTRDepositorInsertCreb5 shRNA (CREB5 Bovine)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
GAL4-Creb5 (1- 128) T59/T61 A
Plasmid#195032PurposeGAL4-Creb5 fusion construct (N-terminus of Creb5,128aa, with T59/T61 A mutation)DepositorInsertGAL4-Creb5 fusion construct (N-terminus of Creb5,128aa, with with T59/T61 A mutation) (CREB5 Bovine)
UseTagsExpressionMammalianMutationT59/T61 APromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
GAL4-Creb5 (1- 128) C18/C23 S
Plasmid#195033PurposeGAL4-Creb5 fusion construct (N-terminus of Creb5,128aa, with C18/C23 S mutation)DepositorInsertGAL4-Creb5 fusion construct (N-terminus of Creb5,128aa, with C18/C23 S mutation) (CREB5 Bovine)
UseTagsExpressionMammalianMutationC18/C23 SPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Bn R52A, R54A pMT2
Plasmid#206087PurposeCav2.2 N-terminus (amino acids 1-95) with R52A and R54A mutations that prevent dominant-negative suppression of Cav2.2 currents by truncated Cav2.2DepositorInsertcacna1b (CACNA1B Rabbit)
UseTagsExpressionMammalianMutationR52A, R54APromoterAd MLP/TPL/SV40Available sinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
B52_puro_gRNA_3418711_KCNB2
Plasmid#197558PurposegRNA targeting upstream region of KCNB2 (site 3418711, control for epigenetic targeting)DepositorInsertupstream KCNB2 promoter gRNA (Kcnb2 Rat)
UseGrna with puromycin selectionTagspuromycin resistance cassette under CMV promotionExpressionMammalianMutationPromoterU6Available sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_SMAD-FOS_Mutant
Plasmid#194188PurposeIncludes the promoter (1kb) of SMTS with mutated SMAD/FOS binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseTagsExpressionMutationmutated SMAD/FOS Site, Region 3-15nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_STAT1-2_Mutant
Plasmid#194189PurposeIncludes the promoter (1kb) of SMTS with mutated STAT1/2 binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseTagsExpressionMutationmutated STAT1/2 site, Region 653-673nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFP-MIOX
Plasmid#166682PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase fused to VP2C-GFP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL1 and GAL10Available sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MIOX only
Plasmid#166681PurposeYeast integrative plasmid for expressing mouse myo-inositol oxygenase (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertMIOX (Miox Budding Yeast, Synthetic, Mouse)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL10Available sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFPdeg
Plasmid#166678PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL1 and GAL10Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFPdeg
Plasmid#166677PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL1 and GAL10Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 mKO2 HuR.DelHNS IRES Puro
Plasmid#110389Purposeγ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsV5 and mKO2ExpressionMammalianMutationHNS (HuR nuclear-cytoplasmic shuttling sequence) …PromoterCMVAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.A18T
Plasmid#99360PurposeBacterial expression vector containing cDNA encoding for the fission yeast tropomyosin, Cdc8 with the amino acid substitution Ala-18-Thr.DepositorInsertcdc8 (cdc8 Fission Yeast)
UseTagsExpressionBacterialMutationAlanine 18 to ThreoninePromoterT7Available sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.E31K
Plasmid#99361PurposeBacterial expression vector containing cDNA encoding for the fission yeast tropomyosin, Cdc8 with the amino acid substitution Glu-31-Lys.DepositorInsertcdc8 (cdc8 Fission Yeast)
UseTagsExpressionBacterialMutationGlutamic acid 31 to LysinePromoterT7Available sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.110
Plasmid#99363PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.110.DepositorInsertcdc8 (cdc8 Fission Yeast)
UseTagsExpressionBacterialMutationAlanine 18 to Threonine and Glutamic acid 31 to L…PromoterT7Available sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK215
Plasmid#72427PurposeAcetobacter aceti 1023 gDNADepositorInsertssuccinyl-diaminopimelate desuccinylase
2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase
acetylglutamate kinase
ribosome biogenesis GTP-binding protein YsxC
insertase
ribonuclease P
50S ribosomal protein L34
hypothetical protein
glyoxylase I
hypothetical protein
UDP-N-acetylglucosamine acyltransferase
3-hydroxyacyl-ACP dehydratase
UDP-3-O-(3-hydroxymyristoyl) glucosamine N-acyltransferase
UsePhage lambda cloning vector with genomic dna inse…TagsExpressionMutationmissing C-terminal domain residues 277-391(ter) a…Promotern/aAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaIrot
Plasmid#24995DepositorInsertIrx5 (Irx5 Mouse)
UseTagsHAExpressionMammalianMutationDeletion of Iro box (aa 314-327), 19 aa upstream …PromoterAvailable sinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaC
Plasmid#24996DepositorInsertIrx5 (Irx5 Mouse)
UseTagsHAExpressionMammalianMutationDeletes everything after Hox Domain (aa 112-177).…PromoterAvailable sinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2A
Plasmid#224440PurposeRep/Cap plasmid for the production of MyoAAV 2A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDQTTL insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4A
Plasmid#224448PurposeRep/Cap plasmid for the production of MyoAAV 4A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYNSL insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1A
Plasmid#224437PurposeRep/Cap plasmid for the production of MyoAAV 1A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDLTTP insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3A
Plasmid#224442PurposeRep/Cap plasmid for the production of MyoAAV 3A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYVGL insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(K36M)-3AID-HA-2A-mCherryBSD
Plasmid#225699PurposeLentiviral expression of AID degron tagged H3.3(K36M) and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationK36MPromoterpEF1AAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Mito-Pericam
Plasmid#87381PurposeRetroviral transfection of cells to express ratiometric Pericam as described by Nagai et al 2001 (PMID 11248055) localising to the mitochondrial matrix via the transit peptide from human COX8A.DepositorInsertMito-Pericam [ratiometric]
UseRetroviralTagsExpressionMammalianMutationPromoterRetroviral 5' LTR promoterAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4E
Plasmid#224452PurposeRep/Cap plasmid for the production of MyoAAV 4E, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDFNNT insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA
Plasmid#166693PurposeExpress dCas9-VPR in a doxycyclin-inducable system and 3 sgRNAs targeting the murine Cnga1 promoter. Can be stably integrated into the genome via the PiggyBac Transposon system.DepositorInsertsdCas9-VPR
3x Cnga1 promoter-targeting sgRNAs
UseCRISPRTagsExpressionMammalianMutationPromoterTRE and U6Available sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1E
Plasmid#224439PurposeRep/Cap plasmid for the production of MyoAAV 1E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDTMSK insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MEKDD
Plasmid#31202DepositorInsertMAPKK1 (MAP2K1 Human)
UseGateway donor vectorTagsExpressionMutationS218D S222DPromoterAvailable sinceJune 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3F
Plasmid#224447PurposeRep/Cap plasmid for the production of MyoAAV 3F, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDHASW insert between amino acids 588 and 589 of…Promoterp41Available sinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(K27M)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225702PurposeLentiviral expression of AID degron tagged H3.3(K27M) and mTurquoise fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mTurquoiseExpressionMammalianMutationK27MPromoterpEF1AAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only