We narrowed to 5,408 results for: U6
-
Plasmid#105024PurposeLentiviral gRNA plasmid targeting mouse Nelfb , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pKLV2-U6gRNA5(Nelfcd-g1)-PGKpuroBFP-W
Plasmid#105025PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g2)-PGKpuroBFP-W
Plasmid#105026PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 CRY2-TSS-guide3
Plasmid#125491PurposeCRISPR-mediated activation of CRY2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 CRY2-TSS-guide2
Plasmid#125490PurposeCRISPR-mediated activation of CRY2. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
FnoCas12a-DR-cr in PBCSK-
Plasmid#126642PurposeCloning vector FnoCas12a DR-crRNA for expression in mammalian cellsDepositorInsertFnoCas12a Full Length Direct Repeat crRNA
UseCRISPRExpressionMammalianPromoterU6 PromoterAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL681 CHYRON4 integration construct
Plasmid#126449PurposeTo integrate the CHYRON4 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON4 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide1
Plasmid#118169PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118163PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118161PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide2
Plasmid#118170PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA1
Plasmid#113130PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianPromoterU6 for gRNA expression, RSV for GFP expressionAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1820_pCR8-DR-RG6-SA-DR
Plasmid#118654PurposeTransient transfection; Expressed DR-RG6-SA-DR CasRx gRNA with preprocessed DR 3'; Gateway DonorDepositorInsertDR-RG6-SA-DR
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgSf3b1(T1)
Plasmid#90424Purposeinduces dsDNA break within mouse Sf3b1 gene for subsequent homology-directed recombination and coding sequence mutagenesis at codon 700DepositorInsertmus Sf3b1 gRNA (Sf3b1 Mouse)
UseCRISPR; Guiderna encoding for gene editingExpressionMammalianPromoterU6Available SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAV hTERTsh
Plasmid#111380PurposeKnock down of hTERT transcriptDepositorInsertshRNA C3 against hTERT
UseAdenoviralPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#3
Plasmid#107731PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE4938
Plasmid#107527PurposeExpresses Fn crRNA and mCherry in mammalian cells.DepositorInsertsFn crRNA
mCherry
ExpressionMammalianPromoterCBh and human U6Available SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only