We narrowed to 3,846 results for: 28
-
Plasmid#209784PurposeExpresses Cre by the specific cTNT promoter and incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)DepositorInsertmiR122 ts
UseAAVPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-JAK1K908E-VSV
Plasmid#139357PurposeExpression of kinase-dead JAK1-K908E proteinDepositorInsertJAK1 cDNA with 300nt of 5' UTR (JAK1 Human)
TagsVSVExpressionMammalianMutationK908EPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXs-LN2
Plasmid#188235PurposePolycistronic human LIN28 and NANOG were cloned into the pMXs vectorDepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA8-Flag-LARS(1-976aa)
Plasmid#139689PurposeExpresses N-teminal Flag tagged aa 1-976 of LARS1DepositorAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-STING-C88S-FLAG
Plasmid#198187PurposeMammalian expression of FLAG-tagged mouse STING1 C88SDepositorAvailable SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-MNDU3-LIN28A-PGK-EGFP-WPRE
Plasmid#89607PurposeExpression of LIN28A in human cellsDepositorAvailable SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hGATE-16
Plasmid#87870PurposeExpress a EGFP-human GATE-16 in mammalian cellsDepositorInsertGATE-16 (GABARAPL2 Human)
ExpressionMammalianAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NOS-IN133.3xFLAG.mCherry-WPRE
Plasmid#127868PurposepAAV plasmid expressing an NOS-IN133.3xFLAG.mCherry fusion protein under the hSyn promoterDepositorInsertNos1 (Nos1 Mouse)
UseAAVTags3xFLAG and mCherryMutationAmino acids 1-133 onlyPromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTMB400_ZFcharm_Prnp_DPM
Plasmid#220847PurposeAAV genome expressing ZFcharm targeting Prnp; double perfect match self-silencing binding siteDepositorInsertZFcharm
UseAAVTagsHAtagExpressionMammalianMutationN/APromoterEFSAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTMB399_ZFcharm_Prnp_SPM
Plasmid#220846PurposeAAV genome expressing ZFcharm targeting Prnp; single perfect match self-silencing binding siteDepositorInsertZFcharm
UseAAVTagsHAtagExpressionMammalianMutationN/APromoterEFSAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-JAK1P1084A-VSV
Plasmid#139358PurposeExpression of the catalytically impaired JAK1-P1084A mutant (corresponding to TYK2-P1104A)DepositorInsertJAK1 cDNA with 300nt of 5' UTR (JAK1 Human)
TagsVSVExpressionMammalianMutationP1084APromoterCMVAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDC184
Plasmid#70055PurposeCo-expresses Syt1-SNARE37aa-linker complex with p045DepositorInsertsHis tagged Synaptobrevin 28-89
Syntaxin 191-256
Tags10xHisExpressionBacterialPromoterT7Available SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-ccdB-mRuby3
Plasmid#166139PurposeGateway destination vector for generation of Galactose-inductibe, C-terminal mRuby3-tagged proteins in yeast. Contains a CEN/ARS element for low copy number when in yeast.DepositorTypeEmpty backboneTagsmRuby3ExpressionYeastAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 VAMP2 R125TAG
Plasmid#69876Purposeexpress in mammalian cells for unnatural amino acid incorporation into VAMP2-GFPDepositorInsertVAMP2-GFP (Vamp2 Rat)
UseSynthetic BiologyTagsGFPExpressionMammalianMutationAmber stop codon in the linker between VAMP2 and …Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-S-WPRE
Plasmid#127867PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP-S fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Human, Mouse)
UseAAVTags3xFLAG and mCherryMutationconstructed by blunt end fusion of the 5’ 51 nucl…PromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEThT-RvCAHS12
Plasmid#192468PurposeBacterial expression of RvCAHS12DepositorInsertCAHS12
TagsHis6ExpressionBacterialPromoterT7Available SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
G-GECO1.2-Orai1Y80E
Plasmid#73565PurposeGreen fluorescent reporter of mutant Orai1Y80E-associated calcium influxDepositorInsertG-GECO1.2-Orai1Y80E (ORAI1 Synthetic, Human)
TagsG-GECO1.2ExpressionMammalianMutationchanged tyrosine 80 of Orai1 to glutamatePromoterCMV Immediate EarlyAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only