We narrowed to 44,705 results for: cha;
-
Plasmid#245850PurposeArchael (Hydrothermarchaeota archaeon JdFR-18) 16S rRNA expressionDepositorInsert16S rRNA
UseOtherAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TagGFP2
Plasmid#121426PurposeTAgGFP2 was amplified from pLenti-Origene-Nrf21 and inserted into XhoI and EcoRI digested pLenti-Origene-Nrf21.DepositorInsertempty TagGFP2
UseLentiviralTagsTagGFP2ExpressionMammalianPromoterCMVAvailable SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Atabey1
Plasmid#245839PurposeArchael (Asgard group archaeon SRVP18_Atabeyarchaeia-1) 16S rRNA expressionDepositorInsert16S rRNA
UseOtherAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-STAT3-linker-TagGFP2
Plasmid#121427PurposeWT STAT3 inserted using Infusion Cloning into MluI and EcoRI digested pLenti-Origene-Nrf21.DepositorInsertSTAT3-linker-TagGFP2
TagsTagGFP2ExpressionMammalianPromoterCMVAvailable SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgSTAT3-1
Plasmid#121425PurposesgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgSTAT3-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgGAL4
Plasmid#121514PurposesgGAL4 control. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgGAL4
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-2
Plasmid#121423PurposesgYAP-2 sequence: GAGATGACTTCCTGAACAGTG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-2
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Flex-rev-GFPFANACfullWT
Plasmid#126551PurposeAAV Flex reverse plasmid with the coding sequence of eGFP fused to the N-term of the FMRFamide gated Na channelDepositorInserteGFP N-terminal fused to FMRFamide gate sodium channel
UseAAVAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJAK175
Plasmid#178601PurposepAP259 derived plasmid encoding a xylose inducible BitlucOptDepositorInsertBitlucopt
ExpressionBacterialPromoterPxylAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO mTRPM7
Plasmid#45482DepositorInsertTRPM7 (Trpm7 Mouse)
UseTetracycline inducibleTagsFlagExpressionMammalianPromoterTetracycline-controlled CMVAvailable SinceMay 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pWP001
Plasmid#178596PurposepAF256 derived plasmid encoding a xylose inducible CD16/50L CBD-SmBiT and LgBiTDepositorInsertCBD-SmBiT/LgBiT
ExpressionBacterialPromoterPxylAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK1tight
Plasmid#89362PurposeA lenti-viral vector expressing photoswitchable MEK1 with minimum basal activity in mammalian cellsDepositorInsertpsMEK1tight (MAP2K1 Synthetic, Human)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianPromoterCMVAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK1
Plasmid#89361PurposeA lenti-viral vector expressing photoswitchable MEK1 in mammalian cellsDepositorInsertpsMEK1 (MAP2K1 Synthetic, Human)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianPromoterCMVAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psMEK2
Plasmid#89363PurposeA lenti-viral vector expressing photoswitchable MEK2 in mammalian cellsDepositorInsertpsMEK2 (MAP2K2 Synthetic, Human)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianPromoterCMVAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-LC122-TAG
Plasmid#226839PurposeContains trastuzumab with a TAG codon at position 122 of the light chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 122 of light chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-HC121-TAG
Plasmid#226836PurposeContains trastuzumab with a TAG codon at position 121 of the heavy chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 121 of heavy chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AntiHer2-HC197-TAG
Plasmid#226838PurposeContains trastuzumab with a TAG codon at position 197 of the heavy chain for ncAA incorporationDepositorInsertsanti-HER2 light chain
anti-HER2 heavy chain
UseAffinity Reagent/ AntibodyExpressionMammalianMutationamino acid 197 of heavy chain mutated to TAGAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PPO-Venus
Plasmid#139502PurposeExpresses Venus-tagged parapinopsin in mammalian cells for photoswitchable control of inhibitory GPCR signaling cascades.DepositorInsertparapinopsin
TagsVenus tag following 3x Ala linkerExpressionMammalianAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PPO-mScarlet
Plasmid#139503PurposeExpresses mScarlet-tagged parapinopsin in mammalian cells for photoswitchable control of inhibitory GPCR signaling cascades.DepositorInsertparapinopsin
TagsmScarlet following Gly-Gly-Ser linkerExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
EcMscS
Plasmid#78555PurposeE. coli Mechanosensitive Channel of Small ConductanceDepositorInsertMechanosensitive Channel of Small Conductance
Tags6x Histidine TagPromoterT7 PromoterAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterEf1aAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 hPHGDH
Plasmid#154916PurposeDoxycyclin inducible expression of human PHGDHDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST PHGDH
Plasmid#154917PurposeExpresses human PHGDHDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST co hPHGDH
Plasmid#154915PurposeExpress codon optimized human PHGDHDepositorInsertPHGDH, codon optimized (PHGDH Synthetic, Human)
UseRetroviralExpressionMammalianMutationCodon optimized for expression in human cellsAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNC1124
Plasmid#41560DepositorInsertUra3-GAL1-UBIYdkGFP*-SpHis5-Tim9
MutationGFP mutations: Phe 64 to Leu, S65 to Thr, V163 t…Available SinceMarch 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNC1125
Plasmid#41561DepositorInsertUra3-GAL1-UBIMdkGFP*-SpHis5-Tim9
MutationGFP mutations: Phe 64 to Leu, S65 to Thr, V163 t…Available SinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNC1136
Plasmid#41562DepositorInsertUra3-FUS1-UBIYdkGFP*-SpHis5-Tim9
MutationGFP mutations: Phe 64 to Leu, S65 to Thr, V163 t…Available SinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNC1137
Plasmid#41563DepositorInsertUra3-FUS1-UBIMdkGFP*-SpHis5-Tim9
MutationGFP mutations: Phe 64 to Leu, S65 to Thr, V163 t…Available SinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-C. thermophilum LIC
Plasmid#74780Purposeencodes GST-tagged dynein light intermediate chain from Chaetomium thermophilumDepositorInsertdynein light intermediate chain (Chaetomium thermophilum)
TagsGSTExpressionBacterialPromoterT7Available SinceMay 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-gst-xr
Plasmid#214761PurposeXylose reductase from Hypocrea jecorina fused with GST-tagged and codon optimized for expression in E. coliDepositorInsertglutathione S-transferases fused with xylose reductase
TagsGlutathione S-transferasesExpressionBacterialPromoterT7Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psRaf1
Plasmid#89364PurposeA lenti-viral vector expressing photoswitchable Raf1 in mammalian cellsDepositorInsertpsRaf1 (RAF1 Synthetic, Human)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianPromoterCMVAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-psCDK5
Plasmid#89365PurposeA lenti-viral vector expressing photoswitchable CDK5 in mammalian cellsDepositorInsertpsCDK5 (CDK5 Synthetic, Human)
UseLentiviralTagsHuman influenza hemagglutinin (HA) tag and pdDron…ExpressionMammalianPromoterCMVAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB-Dual-MBP-NavAb (KAV/G94C/Q150C)
Plasmid#226884PurposeExpresses a mutant of the Arcobacter butzleri voltage-gated sodium channel fused to an MBP tag in insect cellsDepositorInsertNaVAb
TagsMBPExpressionInsectMutationR4A, N49K, L109A, M116VPromoterPolyhedrinAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a S620T
Plasmid#53059PurposeExpresses alpha subunit of S620T hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Serine 620 to ThreoninePromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AiP13584 - pAAV-AiE0475m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3584)
Plasmid#224031PurposeAiE0475m_3xC2 is an enhancer sequence, designed to drive AAV-mediated transgene expression in cortical Chandelier cellsDepositorInsertSYFP2
UseAAVMutationNAPromoterminBGAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 TIM9,10
Plasmid#170280PurposeExpresses both yeast Tim9 and yeast Tim10 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertExpressionBacterialPromoterTim9: via NdeI/XhoI into the MCS2; Tim10: via Bam…Available SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Rabbit Cav 2.2 W391A pMT2
Plasmid#58734Purposeexpression of rabbit CaV2.2 calcium channels with a mutation (W391) in the α1-interacting domain (AID) in the I-II loop of CaV2.2DepositorAvailable SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
AiP14908 - pAAV-AiE0354h-minBG-mScarlet-WPRE3-BGHpA (Alias: CN4908)
Plasmid#224052PurposeAiE0354h is an enhancer sequence, designed to drive AAV-mediated transgene expression in cortical Vip+ neuronsDepositorInsertmScarlet
UseAAVMutationNAPromoterminBGAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only