-
Plasmid#178096PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_F2108L_Dual_pegRNA
Plasmid#178102PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_I2017T_Dual_pegRNA
Plasmid#178103PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA
Plasmid#178108PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-I2017T pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_F2108L_Dual_pegRNA
Plasmid#178109PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-F2108L pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_MTOR_E2419K_Dual_pegRNA
Plasmid#173209PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + MTOR E2419K pegRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
plenti guide ds red
Plasmid#128055PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and DsREd from EF-1a promoter. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianMutationPromoterAvailable sinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
phU6-gRNA
Plasmid#53188PurposeExpresses the S. pyogenes sgRNA from the human U6 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterhuman U6Available sinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmU6-gRNA
Plasmid#53187PurposeExpresses the S. pyogenes sgRNA from the mouse U6 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromotermouse U6Available sinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
gRNA_Cloning Vector BbsI
Plasmid#128433PurposeEmbty backbone vector for expression of gRNA for spCas9 genome editing or epigenome editingDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_Dual_sgRNA
Plasmid#173202PurposeCoselection for PE3 or HDR in human cells. Vector for tandem expression of ATP1A1 G3 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectMutationPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectMutationPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianMutationPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only