We narrowed to 7,341 results for: mCherry
-
Plasmid#186741PurposeDox inducible OTX2-P2A-mCherry expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-anti-mCherry(LaM6) PAGER(Gs)
Plasmid#230011PurposeExpresses anti-mCherry PAGER(Gs) in mammalian cellsDepositorInsertMT1-LaM6-TEVcs-ALFA-hM1Dxs
UseAAVExpressionMammalianPromoterCMVAvailable sinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hGFAP-NEUROD1-T2A-mCherry
Plasmid#178582PurposeExpression of NEUROD1 and mCherry under the human GFAP promoterDepositorAvailable sinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLVX-2xFLAG-2xSTREP-CCND1-IRES-mCherry
Plasmid#172640PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D1 and mCherry in mammalian cellsDepositorAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTP3-AAV-RBFOX3enhancer-mCherry
Plasmid#254715PurposeThis AAV vector contains an enhancer that drives mCherry expression in spinal cord skeletal motor neurons of alpha subtype. Specificity of vector not characterized outside the mouse spinal cord.DepositorInsertRBFOX3 enhancer, mini promoter, synthetic intron, mCherry, WPRE (Rbfox3 Mouse, Synthetic)
UseAAV and Mouse TargetingExpressionMammalianAvailable sinceJune 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-2xTS
Plasmid#162779PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to two tyrosine sulfation (TS) motifs. LaM4-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to two TS sites, T7, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialPromoterT7Available sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB-_attB53
Plasmid#183615PurposeRMCE vector to shuttle puromycin resistance (+), anti-GFP SynNotch receptor (+), tagBFP (-) and TRE-mCherry (-) cassettes into attP50-flanked landing pad (Addgene 183609). (+) = sense (-) = antisense.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FTL
Plasmid#258164PurposeExpresses FTL N terminally tagged with mCherryDepositorAvailable sinceAug. 25, 2026AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry PGK-1 in pcDNA3.1
Plasmid#64214PurposemCherry fused between Cry2 and PGK-1 to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry GRK3 ct in pcDNA3.1
Plasmid#64213PurposemCherry fused between Cry2 and GRK3 ct to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCherry-HMBG1
Plasmid#215130PurposeExpresses mCherry-HMBG1 in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APEX1
Plasmid#215126PurposeExpresses mCherry-APEX1 in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
MLS-TIR1-P2A-mCherry
Plasmid#246222PurposeExpression of MLS-TIR1-P2A-mCherryDepositorInsertMLS-TIR1
TagsMLSExpressionMammalianAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-CMV-NmCherry-mAID
Plasmid#140601PurposeExpression of OsTIR1 and mCherry-mAID protein in DT40 cells under the control of CMV promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NmCherry-mAID
Plasmid#140603PurposeExpression of OsTIR1 and mCherry-mAID protein in mammalian cells under the control of EF1a promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-NLS-BirA-2A-mCherry_Ras
Plasmid#80065PurposeZic2a promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNAS1b split mCherry 14-3-3β
Plasmid#111880PurposeMode #2 phosphosite expression (split mCherry, using 14-3-3β binding domain)DepositorTypeEmpty backboneTagsSplit mCherry system: 14-3-3β fused to C-terminal…ExpressionBacterialAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDH1-CMV-FIP200-mCherry-Hygro
Plasmid#210852PurposeLentiviral expression vector encoding FIP200-mCherryDepositorAvailable sinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-LSL-mCherry-shPtbp1
Plasmid#178591PurposeCre-dependent expression of mCherry and a shRNA against Ptbp1 under the constitutive promoterDepositorInsertmiRE-Ptbp1
UseAAVExpressionMammalianAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only