We narrowed to 10,106 results for: UTY
-
Plasmid#158268PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHSV.Ollas.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.V5_NGFR
Plasmid#158310PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.FLAG_NGFR
Plasmid#158311PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.NWS_NGFR
Plasmid#158312PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.C.HA_NGFR
Plasmid#158313PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.C.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.VSVg.C_NGFR
Plasmid#158263PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.VSVg.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FLAG.VSVg.C_NGFR
Plasmid#158260PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.VSVg.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKK-RNAi-nucCHERRYmiR-TEV-EGFP
Plasmid#105814PurposeFunctional studies using RNAi; rescue experiments; substituting protein for its different form. miRNA cassette with nuclear mCherry expression marker; your protein of interest with C-terminal EGFP.DepositorTypeEmpty backboneUseRNAi; Flp-in competentTagsTEV-EGFPExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCW-Rho(G14V)-HA
Plasmid#247437PurposeHA-tagged human RhoA(G14V) cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianMutationG14V mutation (constitutive active mutant)Available SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4315 IL-10Ra CTEVp chain in PolyTX-mTagBFP2
Plasmid#244171PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): IL10RaSS-3xFLAG-IL10RaECD-IL10RaTMD-CTEVp(190K)-PRS(M)-VP64-ZF6aDepositorInsertMESA CTEVp chain with human IL-10Ra SS, ECD and TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (IL10RA Synthetic, Human)
UseSynthetic BiologyTagsIL10Ra signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4804 VEGFR1 CTEVp chain in PolyTX-mTagBFP2
Plasmid#244174PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): VEGFR1SS-3xFLAG-VEGFR1ECD-VEGFR1TMD-CTEVp(190K)-PRS(M)-VP64-ZF6DepositorInsertMESA CTEVp chain with human VEGFR1 SS, ECD and TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (FLT1 Synthetic, Human)
UseSynthetic BiologyTagsVEGFR1 signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4308 IL-10Rb NTEVp chain (human IgG VH SS) in PolyTX-mNeonGreen
Plasmid#244169PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hIgGVHSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human IgG-VH SS, human IL-10Rb ECD and TMD, and NTEVp 75S mutant (IL10RB Synthetic, Human)
UseSynthetic BiologyTagshuman IgG VH signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4312 IL-10Rb NTEVp chain (human CD8a SS) in PolyTX-mNeonGreen
Plasmid#244170PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hCD8aSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human CD8a SS, human IL-10Rb ECD and TMD, and NTEVp (75S) (IL10RB Synthetic, Human)
UseSynthetic BiologyTagshuman CD8a signal peptide 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4791 VEGFR2 NTEVp chain (75S NTEVp mutant) in PolyTX-mNeonGreen
Plasmid#244172PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): VEGFR2SS-3xFLAG-VEGFR2ECD-VEGFR2TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human VEGFR2 SS, ECD and TMD, and NTEVp (75S) (KDR Synthetic, Human)
UseSynthetic BiologyTagsVEGFR2 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235301PurposeComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2-bGH
Plasmid#235300PurposeComMAND base gene regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235302PurposeComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-V561D-V5/HIS
Plasmid#234762PurposeExpression of the V561D mutant variant of human PDGFRA, which is associated with Gastrointestinal Stromal Tumor and GIST-Plus Syndrome, , constantly activatedDepositorInsertPDGFRA-V561D receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationV561D substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-P577S-V5/HIS
Plasmid#234760PurposeExpression of the P577S mutant variant of human PDGFRA, which might be associated with MelanomaDepositorInsertPDGFRA-P577S receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationP577S substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-R487L-V5/HIS
Plasmid#234761PurposeExpression of the R487L mutant variant of human PDGFRA, which might be associated with Gastrointestinal Stromal TumorDepositorInsertPDGFRA-R487L receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationR487L substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-D842V-V5/HIS
Plasmid#234763PurposeExpression of the D842V mutant variant of human PDGFRA, which is associated with Gastrointestinal Stromal Tumor, constantly activatedDepositorInsertPDGFRA-D842V receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationD842V substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-G853D-V5/HIS
Plasmid#234757PurposeExpression of the G853D mutant variant of human PDGFRA, which might be associated with MelanomaDepositorInsertPDGFRA-G853D receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationG853D substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-T674I-V5/HIS
Plasmid#234756PurposeExpression of the T674I mutant variant of human PDGFRA, which is associated with Idiopathic Hypereosinophilic Syndrome, resistant to imatinibDepositorInsertPDGFRA-T674I receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationT674I substitutionPromoterCMVAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX313_PELO_WT
Plasmid#228938PurposeConstitutive expression of wild-type human PELODepositorAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-K627M-V5/HIS
Plasmid#234755PurposeExpression of the K627M kinase defective mutant variant of human PDGFRADepositorInsertPDGFRA-K627M receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationK627M substitutionPromoterCMVAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCavin1KDR-EGFP
Plasmid#187254PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_Del4UC1_EGFP
Plasmid#229691PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of zebrafish mutant Cavin1 (Del4UC1)DepositorUseLentiviralTagsEGFPMutationDel4UC1PromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-GAL4-UAS—sTNFaR-IRES-mCherry-PGK-BFP
Plasmid#223214PurposeLentiviral vector - mCherry reporter and sTNFaR for Gal4DBDVP64 synNotch receptors with a constitutive BFPDepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha1 nptII-DISTC02-CBS-FRT-Rep-RepA-tNos-DISTC19-CBS-miniDFR-FLP-tNos-PROXC02-pNos-CUP2-Gal4AD-tNos-SF (GB4697)
Plasmid#225440PurposeModule for copper and flippase-regulated expression of BeYDV Rep/RepA, including the TU for copper-regulated FLP, the TU for constitutive expression of CUP2-GAL4, and the nptII cassette.DepositorInsertnptII-DISTC02-CBS-FRT:Rep/RepA:tNos-DISTC19-CBS:miniDFR:FLP:tNos-PROXC02-pNos:CUP2:Gal4AD:tNos-SF
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
AGTR1-DuET
Plasmid#213183PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFR*-CUbo(K63R)-His6
Plasmid#212820PurposeConstitutive or doxycycline-inducible expression of EGFR*-CUbo(K63R)-His6 in mammalian cellsDepositorAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFR*-CUbo(K48R)-GFP
Plasmid#212816PurposeConstitutive or doxycycline-inducible expression of EGFR*-CUbo(K48R)-GFP in mammalian cellsDepositorAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFR*-CUbo(K63R)-GFP
Plasmid#212817PurposeConstitutive or doxycycline-inducible expression of EGFR*-CUbo(K63R)-GFP in mammalian cellsDepositorAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFR*-CUbo(K48R K63R)-GFP
Plasmid#212818PurposeConstitutive or doxycycline-inducible expression of EGFR*-CUbo(K48R K63R)-GFP in mammalian cellsDepositorAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S35A
Plasmid#197562PurposeMammalian expression of myc-tagged human Nix with an alanine substitution of serine-35. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 35 changed to alaninePromoterCMVAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S35D
Plasmid#197563PurposeMammalian expression of myc-tagged human Nix with an aspartic acid substitution of serine-35. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 35 changed to aspartic acidPromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-GFP-AnillinA740D, E758K
Plasmid#187274PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsEGFPMutationAnillin A740D, E758KPromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPLXNB2_PGK_Neo
Plasmid#176848Purposelentiviral vector for constitutive PLXNB2 overexpressionDepositorAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.EFS.eGFP.mArid3a-3'UTR-WT
Plasmid#169299PurposeConstitutive overexpression of the 3'UTR of the murine Arid3a gene after a GFP, to evaluate miRNA binding. Regions not containing miR-125b or let-7c binding regions not included.DepositorAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.C.FLAG_NGFR
Plasmid#158332PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.C.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.C.NWS_NGFR
Plasmid#158333PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.C.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.C.HA_NGFR
Plasmid#158334PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.C.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.C.AU1_NGFR
Plasmid#158335PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.C.AU1MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.C.VSVg_NGFR
Plasmid#158336PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.C.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.FLAG.NWS_NGFR
Plasmid#158342PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.FLAG.NWSMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.FLAG.HA_NGFR
Plasmid#158343PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.FLAG.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.FLAG.AU1_NGFR
Plasmid#158344PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.FLAG.AU1MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only