We narrowed to 23,593 results for: promoter
-
Plasmid#236139PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/ZNF250 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/ZNF250 binding site…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGYL17_pPromALB_enhALB_FireflyLuc
Plasmid#220283PurposeFirefly luciferase with minimal Albumin promoter with a 380 nt, -10.5 kb mouse Alb enhancer cloned into KpnI/XhoI-digested pPromALB_FireflyLucDepositorInsertAlb Enhancer
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGYL18_pPromALB_enhALB_RenillaLuc
Plasmid#220284PurposeRenilla luciferase with minimal Albumin promoter with a 380 nt, -10.5 kb mouse Alb enhancer cloned into KpnI/XhoI-digested pGL4.70 (Promega)DepositorInsertAlb Enhancer
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ107-2x
Plasmid#208812PurposeExpresses SoxS activation domainand gRNA targeting two copies of 107 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 107-2x_mRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSJ106-2x
Plasmid#208860PurposeExpresses SoxS activation domain and gRNA targeting two copies of 106 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 106-2x_mRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyA-GFP
Plasmid#220189PurposesgRNA expression vector - pEM7 promoter with GFP in sgRNA siteDepositorInsertpEM7 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpEM7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyD-GFP
Plasmid#220192PurposesgRNA expression vector - pBG28 promoter with GFP in sgRNA siteDepositorInsertpBG28 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG28Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPIDAF
Plasmid#213716PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIDAF driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPIBY55
Plasmid#213717PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIBY55 driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPICEAM7
Plasmid#213718PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPICEAM7 driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA ins:TDimer mVenus
Plasmid#210520PurposeExpresses a tandem dimer of mVenus in zebrafish pancreatic beta cells using a zebrafish insulin promoterDepositorInsertTandem dimer mVenus
UseZebrafish expression, tol2 kit gateway-compatiblePromoterZebrafish insulin promoterAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
aCE89
Plasmid#204494PurposeTREtight promoted WBeta and PhlF promoted PhiC31 without PEST tagsDepositorInsertsφC31 integrase
WBeta recombinase
UseSynthetic BiologyExpressionBacterial and MammalianPromoterPhIF and TREtightAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
aCE90
Plasmid#204495PurposeTREtight promoted WBeta and PhlF promoted PhiC31 with PEST tagsDepositorInsertsphiC31 recombinase
WBeta recombinase
UseSynthetic BiologyTagsPESTExpressionBacterial and MammalianPromoterPhIF and TREtightAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDA010.188
Plasmid#206792PurposeJ23113.dCas9DepositorInsertdCas9
PromoterJ23113Available SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK389
Plasmid#206791PurposeSp.dCas9, pTet.MCP-SoxS, J23119.gRNADepositorInsertsdCas9
MCP-SoxS
scRNA
PromoterJ23119 and TetAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT009.119.DA9
Plasmid#206803PurposeExpresses DA9 scRNA for activation of pDA303DepositorInsertDA9 scRNA
PromoterJ23119Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-Llgl1-WPRE-UbC-Emerald
Plasmid#203805PurposeLentiviral vector plasmid expressing mouse Llgl1 under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
His SUMO HNRNPA1 dHexa LCD
Plasmid#197014PurposeE. coli expression vectorDepositorInsertHNRNPA1
Tags6His-SUMOExpressionBacterialAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPINA7A2mTFP1(F)
Plasmid#193774PurposeExpresses mTFP1 under the control of PINA7 synthetic promoter, ColE1 origin of replication, Ampicillin selectionDepositorInsertmTFP1
UseSynthetic BiologyExpressionBacterialPromoterPINA7 synthetic promoter carrying binding sites f…Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only