We narrowed to 24,925 results for: crispr
-
Plasmid#195241PurposeMammalian expression of Csm complex (RNase mut) from separate promoters; GFP backbone (Used for RNA binding/tethering)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFLAG-NLS-Csm1; FLAG-NLS-Csm2; FLAG-NLS-Csm3(RNase mut); FLAG-NLS-Csm4; FLAG-NLS-Csm5; FLAG-NLS-Cas6; crRNA; GFP
ExpressionMammalianAvailable sinceFeb. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXT131_TwinStrep-SUMO-ShTniQ
Plasmid#135527PurposeProtein expression construct for ShTniQDepositorInsertShTniQ
TagsTwinStrep-SUMOExpressionBacterialAvailable sinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXT129_TwinStrep-SUMO-ShTnsB
Plasmid#135525PurposeProtein expression construct for ShTnsBDepositorInsertShTnsB
TagsTwinStrep-SUMOExpressionBacterialAvailable sinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
BPK2301
Plasmid#65778PurposeHuman expression plasmid for S. thermophilus 1 Cas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-St1-sgRNADepositorInsertSt1Cas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
SPACE-NG (pRZ5150)
Plasmid#140244PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_NG-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSPACE_NG
ExpressionMammalianMutationV82G in TadA*, NG mutations in SpCas9, D10A in Sp…PromoterCMVAvailable sinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p-dCas9-LSD1-Hygro
Plasmid#104406Purposetransient expression of dCas9-LSD1 fusion proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLSD1 (KDM1A Human)
UseCRISPRExpressionMammalianMutationIRATp970A0364D (Source Bioscience) has a P405H ch…PromoterCMV promoterAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA-BfuAI-2k
Plasmid#112915PurposeEmpty sgRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMB60
Plasmid#47941PurposeCan be used to generate synthetic guide in vitro from T7 promotorDepositorPublicationInsertsynthetic guide RNA
UseCRISPRExpressionWormAvailable sinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p221z-CAS9p-TagRFP-t35s
Plasmid#118386PurposeEntry clone containing CAS9p-TagRFP and 35S terminator. Used to make CRISPR construct . For use in plants and compatible with the MultiSite Gateway systemDepositorInsertCAS9p-TagRFP
UseCRISPRAvailable sinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAC155-pCR8-sgExpression
Plasmid#49045PurposeU6-driven sgRNA expressing cassette on a gateway donor vectorDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available sinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSL1145 (pSPIN, pBBR1 backbone, R*MmeI)
Plasmid#160736PurposeSingle-plasmid V. cholerae CAST, encodes all proteins, crRNA, and donor DNA. Non-targeting crRNA with BsaI sites for spacer cloning. Mini-tn has MmeI site in R end for Tn-seq. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SunTag-FWAgRNA-4-22aa-TET1cd
Plasmid#106435PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRN1120
Plasmid#101750PurposeMulti-copy (2 micron) yeast plasmid containing a functional NatMX marker cassette conferring resistance against nourseothricin. Recipient plasmid for sgRNA or crRNA expression cassettes.DepositorTypeEmpty backboneExpressionYeastAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
dCas9-CBP core
Plasmid#179543Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertS. Pyogenes dCas9 with c-terminal human CBP core (aa 1084-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJEP313-pAAV-CMV-SaCas9-DIO-pA
Plasmid#113690PurposeA CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorAvailable sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p-dCas9-JMJD2A-Hygro
Plasmid#104410Purposetransient expression of dCas9-JMJD2A fusion proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertJMJD2A (KDM4A Human)
UseCRISPRExpressionMammalianPromoterCMV promoterAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only