We narrowed to 691 results for: Bacillus
-
Plasmid#79212PurposeDirected Evolution of Protein-Protein InteractionsDepositorInsertPlacZ-opt (OR1) luxAB; Ptet 434cI-TnTBR3-F7
ExpressionBacterialPromoterPlacZ-opt (OR1); PtetAvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-BSR-GFP11
Plasmid#68716PurposeSplit GFP assayDepositorInsertbsr
UseRetroviralTagsFLAG and GFP11ExpressionMammalianAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSP6-RNAP
Plasmid#48143PurposeShuttle vector E. coli/B.meg.; encoding the RNA polymerase of the phage SP6 under control of the xylose inducible promoter PxylADepositorInsertrna polymerase SP6
UseSynthetic BiologyExpressionBacterialMutationV314A (numbering based on NCBI Sequence ID: NP_85…Available SinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-mNaChBac-P2A-EGFP
Plasmid#176280PurposeViral vector for co-expression of NaChBac and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertmNaChBac-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pT7-soxA
Plasmid#190057PurposeExpress the bacterial monomeric sarcosine oxidase enzyme under the control of the strong constitutif phage promoter T7DepositorInsertSoxA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-IV
Plasmid#53440PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IVDepositorInsertagrBD locus (with D29Y mutation in agrD)
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationD to Y mutation of residue 29 of the agrD gene (c…PromoterT7-lacAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCgVchCAST-crtYf
Plasmid#203816PurposeExpression of CRISPR-associated transposases, shuttle vector for Corynebacterium glutamicum / E. coliDepositorInsertVchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC, CRISPR(crtYf)
UseCRISPRExpressionBacterialAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJT175_GalL_A3A(Y130F)Δ186-BE3
Plasmid#145124PurposeExpressing base editor A3A(Y130F)Δ186-BE3 in yeast cellsDepositorInsertA3A(Y130F)Δ186-BE3
UseCRISPRExpressionYeastMutationA3A(Y130F; 1-186AA); spCas9(D10A)PromoterGalLAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ291-D573A-SRDX
Plasmid#129683PurposeGateway entry clone for CRISPR-Cas12b systemsDepositorInsertBthCas12b-SRDX
UseCRISPR; Gateway compatible bthcas12b entry cloneExpressionPlantMutationD573A; BthCas12b is rice codon optimizedAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3R112C/T180CHFm
Plasmid#85091PurposeExpresses PCNA3 variant (R112C/T180C) fused to heme-FMN domain of P450 BM3 variant (A74G) in E. coliDepositorInsertThe R112C/T180C variant of PCNA3 fused to Heme-FMN domain of P450 BM3
TagsHis6 tagExpressionBacterialMutationR112C/T180C in PCNA3, A74G in heme-FMN domain of …PromoterT7 promoterAvailable SinceDec. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOpen-Bstpol
Plasmid#165543PurposeFull length DNA polymerase from Bacillus stearothermophilus.DepositorInsertBst DNA Polymerase, Full Length
UseSynthetic BiologyAvailable SinceAug. 9, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCWori cytochrome P450-BM3h 9D7
Plasmid#61308PurposeExpresses Cytochrome P450-BM3h 9D7 with C-terminal 6-His tagDepositorInsertCytochrome P450-BM3 heme domain 9D7
Tags6xHisExpressionBacterialMutationT268A, I263A, T438V, A328GPromoterTacAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJMP1
Plasmid#79873PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganADepositorInsertdCas9
UseCRISPRExpressionBacterialMutationD10A, H840APromoterxylAAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBbA5a-sufCDSUB
Plasmid#195055PurposeExpresses SUF operon from B. subtilis from IPTG-inducible promoterDepositorInsertsufCDSUB
ExpressionBacterialAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMP2
Plasmid#79874PurposeBacillus subtilis sgRNA expression vector; integrates into amyEDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pST39-pNL29
Plasmid#91696PurposeExpresses Mega GVs in E.ColiDepositorInsertMega GV gene cluster (from pNL29) in pST39 backbone
TagsNo tagsExpressionBacterialPromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET42b-BE3
Plasmid#87437PurposeExpresses BE3-NLS with an N-terminal His Tag (His6) for bacterial expressionDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only