We narrowed to 10,522 results for: SEC
-
Plasmid#98036PurposeSecond-generation rabies viral vector genomeDepositorInsertEGFP
ExpressionMammalianPromoterCMVAvailable SinceMarch 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
Nup98-pDONR221
Plasmid#124241PurposeGateway entry clone of Drosophila Nup98-96 cDNA.DepositorInsertDrosophila Nup98-96 (Nup98-96 Fly)
ExpressionInsectAvailable SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
13XLexAop2 IVS Jaws mCherry_tr
Plasmid#111551PurposeOptogenetics in Drosophila: LexAop2-induced expressionof Jaws mCherryDepositorInsertJaws_mCherry_trafficked
ExpressionInsectMutationwtPromoterhsp70Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
10XUAS IVS Jaws mVenus_tr
Plasmid#111553PurposeOptogenetics in Drosophila: UAS-induced expression of Jaws mVenusDepositorInsertJaws_mVenus_tr
ExpressionInsectMutationwtPromoterhsp70Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1/V5-HisA-RvCAHS12-GS-AcGFP1
Plasmid#192471PurposeTransient expression of RvCAHS12 (fly codon optimized)-GS_linker-AcGFP1 in Drosophila cellsDepositorInsertCAHS12
TagsAcGFP1ExpressionInsectPromoterAc5Available SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-TAZ CA
Plasmid#79504PurposeMultiSite Gateway entry clones, second fragment (attL5, attL2) Human TAZ S89A mutant CDSDepositorInsertWWTR1 (WWTR1 Human)
UseMultisite gateway entry cloneTags3xFLAGMutationS89APromoterno PromoterAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
TagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF2007
Plasmid#142520PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-BICDR1
Plasmid#111859PurposeFull length BICDR1 for expression in Sf9 cells. 8xHis-ZZ N-terminal tag, TEV site to cleave 8x-His-ZZ.DepositorAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
ORCO-T2A-QF2
Plasmid#162524PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Orco geneDepositorInsertOrco-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Orco-right-HDR-arm
ExpressionInsectAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV_mU6-sgNGN3_hU6-sgRNA_hUbC-PuroR-P2A-GFP
Plasmid#162336PurposeLentiviral expression of sgNGN3 paired with a second S. pyogenes sgRNA with a GFP-P2A-PuroR selection markerDepositorInsertS. pyogenes sgRNA
UseLentiviralExpressionMammalianPromoterhU6; mU6Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
p13xLexAOP2-IVS-Syn21-Voltron-p10
Plasmid#119042PurposeLexAop2-driven expression of Voltron in DrosophilaDepositorInsertVoltron
ExpressionInsectPromoterhsp70Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-6His-Cter (VE5630)
Plasmid#139777PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter6His tag under the pH promoter.DepositorInsertC-terminal 6His tag
Tags6 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-c-Myc-Cter (VE5632)
Plasmid#139778PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter C-Myc tag under the pH promoter.DepositorInsertC-terminal C-Myc tag
Tagsc-MycExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-pH-Flag-Cter (VE5739)
Plasmid#161799PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter Flag tag under the pH promoter.DepositorInsertC-terminal Flag tag
TagsFlagExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-HA-Nter-P10-mCherry (VE5740)
Plasmid#161800PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a N-ter HA tag under the pH promoter.DepositorInsertN-terminal HA tag
TagsHAExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
gfp-Arkadia/ RNF111 deltaRING
Plasmid#112229PurposeExpresses GFP-tagged enzymatically inactive (delta RING) Arkadia in mammalian cellsDepositorInsert(Arkadia)Rnf111 (Rnf111 Mouse)
TagsGFPExpressionMammalianMutationdelta RING domain deletion (Deletion of the last …Available SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A
Plasmid#69792PurposePebble isoform A in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble - Drosophila guanine nucleotide exchange factor
UseP element-based puast vector for gal4-regulated e…TagsHA tagExpressionInsectMutationEncodes Pbl (NP_729306.1) lacking last 9 amino ac…Promoterhsp70 promoterAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
S
Plasmid#167172PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant in Sf9 cellsDepositorInsertsATP1A1-S
ATP1B1
ExpressionBacterial and InsectPromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-UAP56 MUT
Plasmid#110124PurposeExpresses Flag-tagged human UAP56 (DDX39B) with 4 mutations that impact circRNA nuclear export activityDepositorInsertUAP56 (DDX39B Human)
TagsFlagExpressionInsectMutation4 mutations (KSLN motif changed to RSFS)PromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
2xHA MED10 pBacPAK8
Plasmid#17321DepositorAvailable SinceMarch 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
exon L-firefly
Plasmid#81006Purposeluciferase based mini-gene to report splicing at exon 25 in Drosophila paraylticDepositorInsertparalytic (para Fly)
Tagsfirefly luciferaseExpressionInsectMutationspanning exon 24 to exon 26, termination codon in…PromoterP-AC5 (Actin 5C)Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJC-ase0.8kb-TALE3-VP64-P10
Plasmid#104610PurposeExpresses TALE3 under the control of a 0.8kb ase enhancer elementDepositorAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
R725-X09-635: His6-tev-Hs.SPRED1(13-125)
Plasmid#159581PurposeBaculovirus protein expression of His6-tev-Hs.SPRED1(13-125)DepositorAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUAS-CFP-MEK
Plasmid#42077DepositorAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
Rescue Septin 11 mRNA
Plasmid#122025PurposeRescue mRNA for Septin 11 Knock Down with sh2 shRNA. Splice variant II (EU711415) with 5 silent mutations at SEPT11 sh2 shRNA target site.DepositorInsertSEPT11 (Sept11 Rat)
ExpressionMammalianMutationSilent mutations are in 5 consecutive codons (CUG…Available SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
10XUAS IVS Jaws mCherry_tr
Plasmid#111550PurposeOptogenetics in Drosophila: UAS-induced expression of Jaws mCherryDepositorInsertJaws_mCherry_trafficked
ExpressionInsectMutationwtPromoterhsp70Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-ZKSCAN1 548-1417 (No intron)
Plasmid#69887PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in DrosophilaDepositorExpressionInsectMutationF169L in ZKSCAN1PromoterMetallothionein Promoter (pMT)Available SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBacPak-HA-Non-stop
Plasmid#52289PurposeExpresses Drosophila Non-stopDepositorAvailable SinceApril 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
20XUAS IVS Jaws mVenus_tr
Plasmid#111552PurposeOptogenetics in Drosophila: UAS-induced expression of Jaws mVenusDepositorInsertJaws_mVenus_tr
ExpressionInsectMutationwtPromoterhsp70Available SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBiex PKC - Peptide 14 mCit mCer
Plasmid#83565PurposeExpresses a mCitrine-mCerulean FRET sensor containing the catalytic domain of PKCalpha and a short peptide substrate derived from the pseudosubstrate of PKCalpha.DepositorInsertPKC alpha (PRKCA Human)
Tags10 nm ER/K Helix, FLAG Purificaiton Tag, Tev Prot…ExpressionBacterial and InsectMutationOnly catalytic domain of PKC (aa 335-672)PromoterT7 PromoterAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-hDcr-K70A.
Plasmid#89145PurposeExpression of helicase mutant of human Dicer in Sf9 cellsDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIMCyp (owl monkey)(K283D, Q287D)
Plasmid#79036PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorInsertOSF-TRIM5Cyp (owl monkey) (K283D, Q287D)
TagsOneSTrEP-FLAGExpressionInsectMutationChanged Lys 283 to Asp and Gln 287 to AspPromoterpolyhedrinAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-ZKSCAN1 548-1047
Plasmid#69886PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in DrosophilaDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKG01701_CMV-rtTA-betaglobin_pA-CMV-PuroR-bGH
Plasmid#252540PurposeSecondary PiggyBac vector for puromycin selection and expression of transcriptional activatorDepositorInsertrtTA
ExpressionMammalianPromoterCMV (human cytomegalovirus immediate early enhanc…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2147 - pAAV nEF ConFon hChR2(H134R)-mCherry
Plasmid#202545PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-On and Flp-On)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1/CALR ins5-His
Plasmid#214796PurposeBaculovirus expression of human CALR ins5DepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-SNAP25B-WT
Plasmid#248121PurposeMammalian expression lentiviral vector encoding the wild-type Synaptosomal-Associated Protein (SNAP-25)DepositorAvailable SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only