We narrowed to 9,473 results for: BLI
-
Plasmid#229857Purposesingle guide RNA targeting human RB1 geneDepositorInsertRB1sgRNA (RB1 Human)
TagsThe gamma-tubulin sgRNA is coexpressed with 3xFLA…ExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL3-WPRE-UbC-Emerald
Plasmid#225946PurposeLentiviral vector plasmid expressing human atlastin GTPase 3 (ATL3) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-Emerald
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-Emerald
Plasmid#225953PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-mCherry
Plasmid#225954PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-DNMT3Bcd-2A-mTurquoise
Plasmid#225693PurposeLentiviral expression of rTetR(SE) fused to the catalytic domain of DNMT3B and mTurquoise-NLSDepositorInsertrTetR-DNMT3B catalytic domain (DNMT3B Human, Synthetic)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63(YUM1)
Plasmid#203336Purposeepisomal Cas9 and YUM1-targeting sgRNA expression vector for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
YUM1-targeting sequence
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR63
Plasmid#203331Purposeepisomal Cas9 and sgRNA expression vector without sgRNA for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coHPH
ACT1 terminator (S. stipitis)
CCW12 promoter (S. stipitis)
CaCas9
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
THD3 promoter (S. stipitis)
tRNA-sgRNA(SapI)-HDV
ADH1 terminator (S. stipitis)
UseCRISPRExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Creb5(T59/T61A)(HA)
Plasmid#195025PurposeGateway vector containing HA-tagged Creb5 with T59/T61A mutationDepositorInsertHA-tagged Creb5 (full length, 508aa; with with T59/T61A mutation) (CREB5 Bovine)
UseGateway cloningTags3xHAMutationT59/T61AAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Creb5(T59/T61D)(HA)
Plasmid#195026PurposeGateway vector containing HA-tagged Creb5 with T59/T61D mutationDepositorInsertHA-tagged Creb5 (full length, 508aa; with with T59/T61D mutation) (CREB5 Bovine)
UseGateway cloningTags3xHAMutationT59/T61DAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Creb5(HA)
Plasmid#195024PurposeHA-tagged Creb5 in pLenti CMV Puro DEST (w118-1) vectorDepositorInsertHA-tagged Creb5 (full length, 508aa) (CREB5 Bovine)
UseLentiviralTags3xHAExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer20-iCreb5(T59/T61A)(HA)
Plasmid#195027PurposeHA-tagged Creb5(T59/T61A) in pInducer20 lentivirus destination vectorDepositorInsertHA-tagged Creb5 (full length, 508aa; with T59/T61A mutation) (CREB5 Bovine)
UseLentiviralTags3xHAExpressionMammalianMutationT59/T61AAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer20-iCreb5(T59/T61D)(HA)
Plasmid#195028PurposeHA-tagged Creb5(T59/T61D) in pInducer20 lentivirus destination vectorDepositorInsertHA-tagged Creb5 (full length, 508aa; with with T59/T61D mutation) (CREB5 Bovine)
UseLentiviralTags3xHAExpressionMammalianMutationT59/T61DAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
An HA CAAX pMT2
Plasmid#206116Purposeexpression of Cav2.1 N-terminus (amino acids 1-100) with a C-terminal CAAX (last 10aa of H.Ras) motif and a HA tagDepositorAvailable SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
An CAAX pMT2
Plasmid#206118Purposeexpression of Cav2.1 N-terminus (amino acids 1-100) with C-terminal CAAX (last 10 aa of H.Ras) motifDepositorAvailable SinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_WT_1kb
Plasmid#194187PurposeIncludes the promoter (1kb) of SMTS (SMANTIS, MANTIS, AK125871)DepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-MIOX
Plasmid#166680PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFP
Plasmid#166674PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A Prk-
Plasmid#162694Purposep1A negative control expressing CbbLS and inactive Prk (Prk K20M S21A)DepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialMutationPrk inactive (K20M S21A native protein, this map …PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
FMR1-E17B-P2A-NLuc
Plasmid#157857Purposedonor plasmid for FMR1-NlucDepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.27
Plasmid#99362PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.27.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationGlutamic acid 129 to LysinePromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
RGS-6xHis-LIN-29-pcDNA3.1-
Plasmid#52515Purposeexpresses C. elegans LIN-29 in mammalian cells with RGS-6xHis tag at N-terminusDepositorInsertLin-29 b (lin-29 Nematode)
TagsRGS-6xHisExpressionMammalianMutationwt (changed coding sequence in 5' (5th codon…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV5b HA Irx5 deltaHD
Plasmid#24997DepositorAvailable SinceAug. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
HS1BP3-PX (17-139)
Plasmid#119125PurposeBacterial expression of human phox homology (PX) domain, HS1BP3-PX (17-139)DepositorAvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NES
Plasmid#136467PurposeMammalian expression of cytoplasm targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsNuclear export signal from the HIV Rev proteinExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MLS-HyPer7
Plasmid#136470PurposeMammalian expression of mitochondrial matrix targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsTandem mitochondrial targeting signal of cytochro…ExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-NFIA.1-SOX9
Plasmid#182310PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into astrocytes via NFIA and SOX9 expressionUsePiggybacTagsNone and T2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+IMS-HyPer7
Plasmid#136469PurposeMammalian expression of mitochondrial intermembrane space targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsSMAC/DIABLOExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NLS
Plasmid#136468PurposeMammalian expression of nucleus targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsTriple nuclear localization signal of SV40 (simia…ExpressionMammalianPromoterCMV, SP6Available SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
GBX
Plasmid#64123Purposea modified episomal (EBNA1/OriP) vector expressing human eGFP and BCL-xL genesDepositorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HyPer7-MEM
Plasmid#136465PurposeMammalian expression of cytosolic side of plasma membrane targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsFarnselation tagExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
MBX
Plasmid#64122Purposea modified episomal (EBNA1/OriP) vector expressing human BCL2L1 (BCL-xL) geneDepositorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNL(CMV)Luc2-Turbo RFP/CMV/WPREdU3
Plasmid#136959PurposeReporter vector encoding firefly luciferase and TurboRFP fluorescent proteinDepositorInsertFirefly luciferase and TurboRFP
UseLentiviralTagsV5 tagPromoterCMVAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-NFIA.1-SOX9 (bi-directional promoter)
Plasmid#182306PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into astrocytes via NFIA and SOX9 expressionUsePiggybacTagsNone and T2A-mycNLS-mTagBFP2ExpressionMammalianPromoterTRE3G-Bi-directionalAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-SspB-HaloTag-p63DH
Plasmid#176129PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
UseLentiviralAvailable SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-H3.3(WT)-3AID-HA-2A-mTurquoiseBSD
Plasmid#225701PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mTurquoise fused BlasticidinRDepositorUseLentiviralTags3xAID HA and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSpB-iRFP-p63DH
Plasmid#176120PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-FLEX-XRI-FLAG
Plasmid#178057PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with FLAG tag, under UBC promoter with a FLEX switch.DepositorInsertXRI-FLAG
UseAAVTagsFLAG-MBPExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only