We narrowed to 4,689 results for: crispr c plasmids
-
Plasmid#163972PurposeHelper plasmid for cloning gRNAs under the control of the SNR52 promoter.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pX330_MTF2_sgRNA
Plasmid#246402PurposeCas9/sgRNA expression plasmid targeting MTF2DepositorInsertMTF2 (MTF2 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS423-ProSgH
Plasmid#163974PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Pro) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV2 for Split-PE, gRNAs + MMLV-RT(dRH)-P2A-eGFP (PKC1002)
Plasmid#190112PurposeAAV2 for expression of pegRNA and ngRNA (HEKs3, CTT insertion) + MMLV-RT(dRH)-P2A-eGFPDepositorInsertsMMLV-RT(dRH)
U6-pegRNA(HEKs3, CTT ins)-H1-ngRNA(HEK s3)
UseAAVTagsbpNLS and bpNLS-P2A-eGFPMutationmutations from RT in PE2 and truncation of RNAse …PromoterEFS and U6, H1Available SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
v1em-Cterm-PE2max-U6-pegRNA
Plasmid#198733PurposeAAV genome encoding C-terminal PE2max and U6 expression cassetteDepositorInsertNpuC-CtermPE2max
UseAAVPromoterEFSAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a-DNMT3l
Plasmid#154140PurposeExpresses the scFv-GCN4-DNMT3a-DNMT3l fusion protein (more details are shown in the vectro map) for targeted DNA methylation. Should be used in a combination with the dCas9-SunTag systems.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ150-Cas9(dpiRNA)
Plasmid#107940Purposeeft-3p::Cas9(dpiRNA)::tbb-2 3'UTR construct used for MosSCI in nematode. Cas9 is optimized by removing all piRNA targeting sites to allow germline expression.DepositorInsertCas9(dpiRNA)
ExpressionWormPromotereft-3Available SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS-Cas9
Plasmid#120353PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). SpCas9 is constitutively expressed.DepositorInsertOKMS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [10-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-H2BC11_sgRNA
Plasmid#183881PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS-KRAB-dCas9
Plasmid#120356PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). KRAB-dCas9 is constitutively expressed.DepositorInsertOKMS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [10-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-(Spyo_Cas9)-6xHis-NLS(SV40)
Plasmid#185706PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(Spyo_Cas9) with an N-terminal NLS and C-terminal NLSDepositorInsertCas9
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
hNTo1-qgRNA-pYJA5
Plasmid#217781PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTo2-qgRNA-pYJA5
Plasmid#217782PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVDnmt3L_bGHpA
Plasmid#177350PurposeAAV expression of scFV-fused C terminal domain of Dnmt3l for targeted DNA methylation editingDepositorInsertC-terminal domain of mouse Dnmt3l (Dnmt3l Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation194–415 aaPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLY080b_AAV_EFS-4D5-CD8-28BBz (HER2 CAR)
Plasmid#192190PurposeHER2 CAR AAV vector PRODH2 KI (pLY080b)DepositorInsertHER2 CAR AAV vector PRODH2 KI (pLY080b) (ERBB2 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601‐MHP1‐ABEmaxC2‐NG‐E53 ogRNA
Plasmid#187068PurposeGp41-1 Split C-terminal half of ABEmaxNGA driven by MHP1 promoter with gRNA targeting mdx4cv nonsense mutationDepositorInsertGp41-ABEmaxC2‐NG
UseAAVExpressionMammalianPromoterMHP1Available SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only