We narrowed to 31,447 results for: ide
-
Plasmid#45583DepositorInsertConstitutively active mDia1 (CA-mDia1) (Diaph1 Mouse)
TagsGFPExpressionMammalianMutationInsert mDia1 contains mutations V161D and N165D i…PromoterCMVAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P CISD1_1
Plasmid#160773PurposeSuppress CISD1DepositorInsertshCISD1_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P CISD1_2
Plasmid#160774PurposeSuppress CISD1DepositorInsertshCISD1_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRF+423Dux4
Plasmid#21625DepositorInsertDouble homeobox, chr 4 (DUX4 Human)
UseLuciferaseAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGL3 Zscan4 promoter
Plasmid#69249PurposeLuciferase reporter for Dux4 activation of Zscan4 transcriptionDepositorInsertZscan4 (ZSCAN4 Human)
UseLuciferaseMutationThe two single nucleotide mismatches found betwee…PromoterZscan4Available SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P CISD2_2
Plasmid#160776PurposeSuppress CISD2DepositorInsertshCISD2_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P CISD2_1
Plasmid#160775PurposeSuppress CISD2DepositorInsertshCISD2_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV EF1a DIO iChloC 2A dsRed
Plasmid#70762PurposeAn improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Cre inducible expression (double floxed inversed ORF)DepositorInsertsChannelrhodopsin-2
red fluorescent protein
UseAAVExpressionMammalianMutationE83Q,E90R,E101S,D156N,T159CPromoterEF1aAvailable SinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-Mef2c-tPT2A-GFP
Plasmid#111771PurposeBicistronic construct: Co-express two genes by 2A peptidesDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
SnapTag-Binder
Plasmid#179142PurposeBinder: SspB that carries two point mutations reducing homodimerization(Y11K/A15E, residue numbering from pdb: 1ou9). Binder binds to the 7 a.a. peptide SsrA (AANDENY).DepositorInsertSspB
TagsSNAP-tagExpressionMammalianMutationY11K/A15E, residue numbering from pdb: 1ou9Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINTBxb1
Plasmid#127519PurposePlasmid encodes H. sapiens codon optimized Integrase Bxb1.DepositorInsertIntegrase Bxb1 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_004 - hU6-DR_BsmBI-EFS-PspCas13b-NES-2A-Puro-WPRE
Plasmid#138146PurposeExpresses PspCas13b in mammalian cells, localized in the cytoplasm. For cloning guide RNAs compatible with PspCas13b. Contains a 3' direct repeat. Clone using BsmBI. F overhang acac. R overhang caacDepositorInsertPspCas13b
UseLentiviralTagsNESAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Flag-mCherry-Binder
Plasmid#179139PurposeBinder: SspB that carries two point mutations reducing homodimerization(Y11K/A15E, residue numbering from pdb: 1ou9). Binder binds to the 7 a.a. peptide SsrA (AANDENY).DepositorInsertSspB
TagsFLAG and mCherryExpressionMammalianMutationY11K/A15E, residue numbering from pdb: 1ou9Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET20b_Pa-PiuA
Plasmid#128955Purposeexpresses Pseudomonas aeruginosa PiuA in E. coliDepositorInsertiron transport outer membrane receptor (PiuA) (PA4514 Pseudomonas aeruginosa PAO1)
Tags6xHis and pelB leaderExpressionBacterialMutationSignal peptide sequence has been removedPromoterT7Available SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-EGFP-Vasa 463-661 MUT (F504E) (HK196)
Plasmid#206434PurposeVasa 463-661 expression in Schneider cells for imagingDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET20b_Pa-PirA
Plasmid#128956Purposeexpresses Pseudomonas aeruginosa PirA in E. coliDepositorInsertferric enterobactin receptor PirA (pirA Synthetic, Pseudomonas aeruginosa PAO1)
Tags6xHis and pelB leaderExpressionBacterialMutationSignal peptide sequence has been removedPromoterT7Available SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC3.1_CMV_oROS-G_LF(C199S)
Plasmid#216112PurposeExpresses the loss-of-function mutations C199S of the genetically encoded green fluorescent hydrogen peroxide sensor oROS-G in mamalian cells.DepositorInsertoROS-G_LF(C199S)
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiRNACRISPR_001 - hU6-DR_BsmBI-EFS-PguCas13b-NLS-2A-Puro-WPRE
Plasmid#138143PurposeExpresses PguCas13b in mammalian cells, localized in the nucleus. For cloning of guide RNAs compatible with PguCas13b. Contains a 3' direct repeat. Clone using BsmBI. F overhang cacc. R overhang caacDepositorInsertPguCas13b
UseLentiviralTagsNLSAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only