We narrowed to 880 results for: grna cloning vector
-
Plasmid#137876PurposePiggyBac vector for expression of 1x gRNA targeting TCF4 for CRISPRa;mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pMH183
Plasmid#122856PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate D-E flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJF131B
Plasmid#113326PurposepTet-W108 scRNA.b2, pTet-RR2-sgRNADepositorInsertW108 scRNA_MS2 and sgRNA_RR2
UseCRISPRExpressionBacterialAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Luc-A
Plasmid#25756PurposeEntry vector with human U6 promoter driving control Luciferase miR30-based shRNA.DepositorInsertLuciferase miR-shRNA
UseGateway CloningAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEN_TGmiR_Gb2-K
Plasmid#25766PurposeEntry vector withTRE promoter driving mouse G beta 2 miR30-based shRNA with GFP coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSI-218
Plasmid#197139PurposeAll-in-vector of SpCas9 gRNA cloning sites (BsmBI) and CMVp-Target-AID expression unitDepositorTypeEmpty backboneUseCRISPRTagsSpCas9-PmCDA1-UGIExpressionMammalianMutationSpCas9(D10A)Available SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCD296.7
Plasmid#113320PurposedCas9, MCP-TetD, J107 scRNA.b1DepositorInsertdCas9, MCP-TetD, J107 scRNA.b1_MS2
UseCRISPRExpressionBacterialAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECNUS2
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti U6_r2ad_ IN-PE2-SSB_PuroR
Plasmid#254321PurposeA lentiviral vector expressing a modified version of PE2 with a prime editing gRNA cloning site. Peptide fusion (Velimirovic et al.) and fusion with the La protein (Yan et al.) enhance PE efficiencyDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_G13-L_G12-E
Plasmid#25763PurposeEntry vector with TRE promoter driving both mouse G alpha 12 and G alpha 13 miR30-based shRNAs.DepositorInsertG alpha 13 and 12 miR-shRNA
UseGateway CloningAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-G13-L
Plasmid#25758PurposeEntry vector with human U6 promoter driving mouse G alpha 13 miR30-based shRNA.DepositorInsertG alpha 13 miR-shRNA
UseGateway CloningAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pPN441
Plasmid#137873PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKHH030
Plasmid#89358PurposehU6 sgRNA cloning vector for CDKO systemDepositorInsertGFP, Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
PMXS-GOT1
Plasmid#72872PurposeThe retroviral GOT1 vector was generated by cloning an sgRNA resistant human GOT1 gene block into the pMXS-ires-blast vector by Gibson Assembly.DepositorInsertGOT1 (GOT1 Human)
UseRetroviralExpressionMammalianMutationsgRNA resistant human GOT1, 7 silent mutations c1…Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB_p300_core-dCas9-EGFP_hygro
Plasmid#226431PurposePiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection markerDepositorInsertsp300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, P2A-EGFP, and p300 coreExpressionMammalianPromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-Exoc7-Ex5&10
Plasmid#133303PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.DepositorInsertExocyst complex component 7 (Exoc7 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromotermU6 promoterAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231365PurposeminBG-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231366PurposePle155-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA290
Plasmid#215949PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD55_v4; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA286
Plasmid#215948PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v6; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA427
Plasmid#215961PurposeFragmid fragment: (guide cassette) enables iBar UMIsDepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v5; trRNA_v6 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMH184
Plasmid#122857PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate E-F flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJF121
Plasmid#113325PurposepTet-W108 scRNA.b2DepositorInsertW108 scRNA_MS2
UseCRISPRExpressionBacterialAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCD294.9
Plasmid#113319PurposedCas9, PCP-SoxS_R93A, J109 scRNA.b1DepositorInsertdCas9, PCP-SoxS_R93A, J109 scRNA.b1_PP7
UseCRISPRExpressionBacterialMutationR93AAvailable SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCD005
Plasmid#113314PurposeW108 scRNADepositorInsertW108 scRNA_MS2
UseCRISPRExpressionBacterialAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-G12-E
Plasmid#25757PurposeEntry vector with human U6 promoter driving mouse G alpha 12 miR30-based shRNA.DepositorInsertG alpha 12 miR-shRNA (Gna12 Mouse)
UseGateway CloningAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only