We narrowed to 6,625 results for: GFP expression plasmids
-
Plasmid#187598PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Gentamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.0_mitoLAMA-F98 IRES EGFP
Plasmid#130706PurposePlasmid encoding outer mitochondrial localization of LAMA-F98 for GFP as a SNAP-Tag-fusion and EGFPDepositorInsertNTOM20-SNAP-Tag-LAMA-F98 IRES EGFP
TagsNTOM20 and SNAP-TagExpressionMammalianAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
SL016: AAV-CAG-FLEX-CheRiff-GFP
Plasmid#124776PurposeFor AAV based expression of CheRiff in Cre-Positive cellsDepositorInsertCheRiff-GFP
UseAAV and Cre/LoxTagsGFPPromoterCAGAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMBEC2
Plasmid#187596PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Kanamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/Flag-tGFP
Plasmid#110375PurposeMammalian expression of turboGFP with FLAG tag, Flp-In T-Rex systemDepositorInsertturboGFP
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR_EF1a-->Gss52SR4-LaM4-P2A-NLSIFP
Plasmid#162229PurposeLentiviral vector for the expression of Gss52SR4-LaM4-P2A-NLSIFP in mammalian cellsDepositorInsertLaG17 GFP nanobody SynNotch tTA
UseLentiviralExpressionMammalianAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
IX_pAAV-ProB3-CatCh-GFP-WPRE
Plasmid#125923PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVPromoterProB3Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUB_SM-FLuc0-GFPOPT
Plasmid#210594PurposeExpresses SM(FLAG)-nonoptimal Firefly luciferase-optimal GFPDepositorInsertSpaghetti monster (FLAG)-nonoptimal FLuc-Optimal GFP
UseLuciferaseTagsSpaghetti monster (FLAG)ExpressionMammalianPromoterUBC humanAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUB_SM-Fluc100-GFPOPT
Plasmid#210596PurposeExpresses SM(FLAG)-optimal Firefly luciferase-optimal GFPDepositorInsertSpaghetti monster (FLAG)-optimal FLuc-Optimal GFP
UseLuciferaseTagsSpaghetti monster (FLAG)ExpressionMammalianPromoterUBC humanAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL1180-NiV L(2k)-mCherry/eGFP
Plasmid#234654PurposeMinigenome plasmid of NiV Bangladesh strainDepositorInsertspart L gene
mCherry
eGFP
UseIn cell lines expressing bacteriophage t7 rna pol…ExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
ZsGreen1-cMYC/pLVX-Puromycin
Plasmid#180278PurposePlasmid encoding human c-MYC for reporter assays. Polycistronic puromycin selectable lentiviral vector (unmodified, from TAKARA BIO).DepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yEPAGFP-CaUra3
Plasmid#44649DepositorInsertyEPAGFP
ExpressionYeastAvailable SinceMay 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
RNb-GFP
Plasmid#128777PurposeMammalian expressionDepositorInsertRNb-GFP
ExpressionMammalianAvailable SinceFeb. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGFP CrkII
Plasmid#50730Purposemammalian expression of GFP-CrkII. Note- This plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV::hTfR-GFP
Plasmid#199714PurposeExpresses a chimera of human transferrin receptor (hTfR) and GFP in mammalian cells.DepositorInserthTfR-GFP
UseAAVExpressionMammalianPromoterCMVAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 hSyn1-Lck-GFP
Plasmid#177333PurposeExpresses GFP on the plasma membrane of neurons via an Lck localization sequenceDepositorInsertLck-GFP
UseAAVTagsGFPExpressionBacterialPromoterhSyn1Available SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2234 - pAAV Nestin GFP-iCre
Plasmid#228443PurposeAn adeno-associated viral vector to express GFP-iCre fusion protein under the human Nestin 2nd intron enhancer.DepositorInsertGFP-iCre
UseAAVExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-0.5Syn-7 MInGFP-WPRE-pA
Plasmid#233061PurposeTo express 7 Min GFP from a 0.5 bp synapsin promoter. The non-coding BDNF exon one is 5' to the BDNF start codon.DepositorInsert7 Min GFP
UseLentiviralAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iC
Plasmid#231418PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-C1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ290.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iA
Plasmid#231417PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-A1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ285.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSMART-HCKan-yibDp-VHH-GFPenhancer
Plasmid#202468PurposeExpresses the nanobody GFP enhancer after phosphate depletionDepositorInsertnanobody GFP enhancer
Tags6X-HisExpressionBacterialPromoteryibDpAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMART-HCKan-yibDp-VHH-GFPminimizer
Plasmid#202469PurposeExpresses the nanobody GFP minimizer after phosphate depletionDepositorInsertnanobody GFP minimizer
Tags6X-HisExpressionBacterialPromoteryibDpAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
Zhou-pLOV-GFP-Luc
Plasmid#161030PurposeLentiviral vector expressing GFP and luciferase for use as a reporter in pseudovirus production and infection.DepositorInsertGFP and luciferase
UseLentiviralAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRMTK-clo39
Plasmid#204014PurposeCloning plasmid containing the sfGFP insert with a chloramphenicol resistance markerDepositorInsertsuper folder green fluorescent protein
ExpressionPlantPromoterN/AAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
p09008_AF1-4+GFP5-7
Plasmid#173715PurposePlasmid backbone for the HyperXpress workflow containing new to nature hybrid GFP with strong fluorescence in E. coli cell free protein synthesis extracts.DepositorInsertshybrid GFP
mKate2
UseE. coli cell free protein synthesis extractsExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + mMALAT1_3'
Plasmid#91803PurposeExpresses a cGFP mRNA that ends in the MALAT1 triple helix when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
p663-UBC-V5-eGFP_IDG-K
Plasmid#135265PurposeGateway destination clone of eGFP (as control) tagged with N-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertV5-eGFP
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianPromoterUbiquitinAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
LC801: pMVP (L3-L2) eGFP + WPRE
Plasmid#121771PurposepMVP L3-L2 entry plasmid, contains eGFP + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term eGFP fusion to gene of interest in lentivirus vectors.DepositorInserteGFP + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHL1948
Plasmid#53046PurposePconNoHindM12:glgC::gfp, PconNoHind:RBS(st3):tetR, PconNoHindM10:RBS(st3):csrADepositorInsertsGFP
tetR
csrA
UseSynthetic BiologyTagsRBS(st3) and glgC leaderExpressionBacterialPromoterpConNoHind, pConNoHindM10, and pConNoHindM12Available SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHL1947
Plasmid#53045PurposePconNoHindM12:glgC::gfp, PconNoHind:RBS(st3):tetR, PconNoHindM8:RBS(st3):csrADepositorInsertsGFP
tetR
csrA
UseSynthetic BiologyTagsRBS(st3) and glgC leaderExpressionBacterialPromoterpConNoHind, pConNoHindM12, and pConNoHindM8Available SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-myr-EGFP-LDLR(Ct)
Plasmid#213402Purposedouple floxed, myristoylation (myr) site for membrane targeting and EGFPDepositorInsertEGFP
UseAAVTagsC-terminal (Ct) cytoplasmic domains of low densit…ExpressionMammalianAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDD373
Plasmid#137021PurposeSapTrap GFP-GLO donorDepositorInsertC. elegans GLO-optimized GFP
UseCRISPR; Saptrap donor for cloning repair templat…TagsC. elegans GLO-optimized GFPExpressionWormAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SYN1>Fas-EGFP:P2A:mNaChBac.
Plasmid#242230PurposeExpress Fas-EGFP and mNaChBac in neuronsDepositorInsertsFas
EGFP
P2A
mNachBac
UseAAVExpressionMammalianPromoterSYNAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xControlgRNA
Plasmid#224583PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP963-Ai193 (TICL-EGFP-ICF-tdT)
Plasmid#181759Purposetargeting vectorDepositorInsertEGFP and tdTomato
ExpressionMammalianAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pmEos3.1-N1 GBP
Plasmid#220492PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos3.1 to track GFP proteins of interest to perform Fluorescent intrabody Localization MicroscopyDepositorInsertGFP Binding Protein tagged with mEos3.1
TagsmEos3.1ExpressionMammalianAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
GTT-g
Plasmid#81109PurposeGene Tagging vector TRP/GFP - Plasmid for superfolder GFP (sfGFP) labeling of endogenous proteins with a TRP selection marker, originating from pSIVt (ID:81092)DepositorInsertsfGFP
UseCre/LoxTagssfGFPExpressionYeastAvailable SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCI_FLAG-GFP(Y39TAG)-6His
Plasmid#223507PurposeFluorescent reporter plasmid for genetic code expansion which consists of a modified GFP with a Amber stop codon on position Y39DepositorInsertGFP(Y39TAG)
Tags6xHis and FLAGExpressionMammalianMutationY39TAGAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD_FLAG-GFP(Y39TAG)-6His
Plasmid#223510PurposeFluorescent reporter plasmid for genetic code expansion which consists of a modified GFP with a Amber stop codon on position Y39DepositorInsertGFP(Y39TAG)
Tags6xHis and FLAGExpressionBacterialMutationY39TAGAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK-EGFP-FKBPF36V
Plasmid#199765Purposeplasmid for targeting dTAG into the AAVS1 locusDepositorInsertGFP-dTAG
TagsGFP and dTAGExpressionMammalian and WormPromoterhPGKAvailable SinceJune 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-Ezr-eGFP
Plasmid#176856PurposeExpresses Ezrin fused with eGFP at the C-terminus in astrocytesDepositorInsertEzr-GFP
UseAAVTagsGFPExpressionBacterialPromotergfaABC1DAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBTG2
Plasmid#149475PurposeBroad-Host range expression vector, pBBR origin, TetR repressor, PTetA promoter, GFPmut3b, Kanamycin Resistance Marker.DepositorInsertTetR-GFP
UseSynthetic BiologyExpressionBacterialPromoterPTetAAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-FLEX-rc [SomArchon-GFP]
Plasmid#153533PurposeAAV-mediated expression of SomArchon-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterSynAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only