We narrowed to 12,061 results for: shRNA
-
Plasmid#194152PurposesgRNA expression in A. baumannii for CRISPRi. Replicative plasmid, CarbR. Contains mrfp nontargeting control guide sequence.DepositorInsertsgRNA with mrfp control guide sequence
ExpressionBacterialPromoterJ23119Available SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMGIB-3xFLAG-reptin
Plasmid#53609PurposeRetroviral expression of human reptinDepositorInsertreptin (RUVBL2 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationCDS mutated to confer resistance to shRNA. All mu…PromoterLTRAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC588
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-UGCG-KO
Plasmid#80010PurposegRNA to knock out expression of UGCG gene. The product of this gene catalyzes the first step in synthesis of glycosphingolipids.DepositorInsertUGCG (UGCG Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 2
Plasmid#70658PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-RING1_2
Plasmid#36356DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
Circular 100,50 (RAB7A)
Plasmid#170117PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorInsertCircular 100,50 guide RNA
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459 sgAtg5
Plasmid#175023PurposeCRISPR-Cas9 plasmid targeting exon 2 of human Atg5.DepositorInsertATG5 (ATG5 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xPP7_SL]
Plasmid#68424PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertINT construct bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
LL - hOCT4i -2
Plasmid#12197DepositorAvailable SinceSept. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
MASTL B4.4 gRNA
Plasmid#90755Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation B4.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVG1
Plasmid#111444PurposeUnified Solo vector pV1382 + sgScADE2 + ScADE2 stop codon repair tempateDepositorInsertCaCas9/sgScADE2/stop-codon repair
UseCRISPRExpressionYeastAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
gh19
Plasmid#106703Purposeexpression of gRNA targeting GALNT19DepositorInsertGALNT19
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
KIF20A D5.2 gRNA
Plasmid#90718Purpose3rd generation lentiviral gRNA plasmid targeting human KIF20ADepositorInsertKIF20A (Guide Designation D5.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXD017-39 TRAC PDCD1 AAV double KO AAV
Plasmid#192153PurposeTRAC PDCD1 AAV double KO AAVDepositorInsertsgRNA
UseAAVMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX-EGFP-g1
Plasmid#107273PurposeeGFP sgRNA-1 and Cas9 expression vector (aka. pX-ps1)DepositorInsertGFP sgRNA-1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only