We narrowed to 31,119 results for: PLE
-
Plasmid#55640PurposeDre-Dependent ChR2-EYFPDepositorInserthChR2(H134R)-EYFP
UseAAVTagsEYFPExpressionMammalianPromoterEf1aAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GRK3
Plasmid#32689DepositorAvailable SinceFeb. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGGB_YFP-MiniTurboID
Plasmid#222433PurposeGolden Gate / Green Gate module for adding YFP and MiniTurboID as N-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hsRPA32 (MSW#497)
Plasmid#208068PurposeExpression of GFP-tagged hsRPA2 in human cellsDepositorAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL1145 (pSPIN, pBBR1 backbone, R*MmeI)
Plasmid#160736PurposeSingle-plasmid V. cholerae CAST, encodes all proteins, crRNA, and donor DNA. Non-targeting crRNA with BsaI sites for spacer cloning. Mini-tn has MmeI site in R end for Tn-seq. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXW109Hg(RS-RinA-E11)2
Plasmid#123151PurposeMercury sensor with three-layered amplifier cascade. Need to work with plasmid pXWP11-gfp2. pSB4A3 carrying J109-32merR-t-PmerT-30hrpR-30hrpS-t-PhrpLE-30RinA(ASV)-t-PrinA-33ECF11-tDepositorInsertJ109-32merR-t-PmerT-30hrpR-30hrpS-t-PhrpLE-30RinA(ASV)-t-PrinA-33ECF11-t
UseSynthetic BiologyExpressionBacterialPromoterJ109, PmerT, PhrpLE, PrinAAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE1-1_pLVX-EF1a-BirA-P2A-FB-dCas9-IRES-zsGreen1
Plasmid#138417PurposeCAPTURE1.1 vector containing BirA-V5-His, P2A, FB-dCas9, IRES and zsGreen1DepositorInsertsBirA
dCas9
UseLentiviralTagsFLAG, Avi-tag and V5, HisPromoterEF1aAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGAPTrap-GFP
Plasmid#82506PurposeVector targeting the eGFP gene to the GAPDH locus of human cells. eGFP is expressed from a 2A sequence at the C terminus of GAPDH.DepositorInserteGFP
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
LiOn-CAG∞GFP
Plasmid#154015PurposeVector based on the LiOn integration-coupled translational switch (Kumamoto et al bioRxiv 2019) expressing the fluorescent protein EGFP from a CAG promoter upon action of the piggyBac transposaseDepositorInsertEGFP
ExpressionMammalianPromoterCAGAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mCherry-IRES-Dre
Plasmid#55633PurposeExpresses Dre in Mammalian CellsDepositorInsertsmCherry
Dre
UseAAVExpressionMammalianPromoterEf1a and Ef1a/IRESAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-BCR-ABL-p190-FLAG
Plasmid#205620PurposeExpression of BCR-ABL oncogene in mammalian cellsDepositorInsertBCR-ABL oncogene, p190 isoform b3a2
TagsFLAGExpressionMammalianMutationT117M- Please see depositor commentsPromoterCMVAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJZC78
Plasmid#62339PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGD_MiniTurboID-YFP
Plasmid#222434PurposeGolden Gate / Green Gate module for adding MiniTurboID and YFP as C-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLQ8629 pHR-HREYBTATA-RR12EE345L-C term (406) dLbCpf1-2XNLS-miniVPR-mCherry-EFS-Puro-WPRE
Plasmid#140227PurposeHypoxia-inducible expression of leucine zipper with C terminal dCpf1 (Cas12a) 406-split half fused to miniVPR. Constitutive EFS-driven puromycin resistance.DepositorInsertzipper with dLbCpf1 (Cas12a) C terminal half (406) fused to miniVPR
UseLentiviralExpressionMammalianPromoterHRE (Hypoxia inducible)Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-NOG(AtUBI10)
Plasmid#202016PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-sfGFP-VP64-GB1) under the control of the AtUBI10 promoter.DepositorInsertsdCas9-24XGP41
NbGP41P-sfGFP-VP64-GB1
TagsGB1 and sfGFPExpressionPlantPromoterAtUBI10Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC-GFP-MCC
Plasmid#133307Purpose"Burdensome" GFP expressing plasmid carrying microcin-V bacteriocin for plasmid stabilisationDepositorInsertmicrocin-V bacteriocin cassette (cvaC E. coli)
UseSynthetic BiologyExpressionBacterialMutationN112D (please see depositors comments)Available SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only