We narrowed to 4,634 results for: HRE
-
Plasmid#99360PurposeBacterial expression vector containing cDNA encoding for the fission yeast tropomyosin, Cdc8 with the amino acid substitution Ala-18-Thr.DepositorInsertcdc8 (cdc8 Fission Yeast)
UseTagsExpressionBacterialMutationAlanine 18 to ThreoninePromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.110
Plasmid#99363PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.110.DepositorInsertcdc8 (cdc8 Fission Yeast)
UseTagsExpressionBacterialMutationAlanine 18 to Threonine and Glutamic acid 31 to L…PromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH731-2µ-RLuc/minCFLuc
Plasmid#40601DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterminimal TATA-box promoter with low basal activityAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Tet-MKK6(DD)-Puro
Plasmid#86094PurposeTet/Dox inducible (TetR) constitutively active mutant MKK6/MAP2K6 in lentiviral vectorDepositorInsertMKK6 (MAP2K6 Human)
UseLentiviralTagsMyc tagExpressionMammalianMutationSerine 207 and Threonine 211 both changed to Aspa…PromoterCMV/TetOAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMG071 MBP-GSK3β_S9A-HA-His, GST_λPPase
Plasmid#196185PurposeCo-expresses MBP-GSK3β_S9A-HA-His (human GSK3β with S9A mutation as a fusion protein with MBP, HA, and His-tags) and GST_λPPase in E.coli to produce unphosphorylated MBP-GSK3β_S9A-HA-HisDepositorInsertsUseTagsGST, HA, His6, and MBPExpressionBacterialMutationchanged Serine 9 to AlaninePromoterTacAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ1A
Plasmid#197381PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-1 σ1A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-1 σ1A
UseTagsGAL4-DNA binding domain fragment, HA tag, and SV4…ExpressionYeastMutationContains an extra 42 nucleotides encoding 14 resi…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
Flag-KLF6-4D (1054)
Plasmid#49490Purposeexpresses human Flag tagged KLF6 with 4D mutationDepositorInsertKFL6-4D (KLF6 Human)
UseTagsFlagExpressionMammalianMutationthree serines and one tyrosine mutated to aspart…PromoterCMVAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
RKF1 X030_pECIA14
Plasmid#114856PurposePrey vector RKF1 X030_pECIA14 should be used with bait vector RKF1 X030_pECIA2.DepositorInsertAT1G29750 (RKF1 Mustard Weed)
UseTagsExpressionInsectMutationPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 A82V/T230A/D637G 2014 EBOV Delta-Mucin-Like-Domain
Plasmid#86026PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
UseTagsExpressionMammalianMutationLacks mucin-like domain; Changed alanine 82 to va…PromoterCMV IEAvailable SinceJuly 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_WT&Mut-SM
Plasmid#215916PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_WT&Mut (BRAF Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_WT-SM
Plasmid#215917PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ WT (BRAF Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_Mut1-SM
Plasmid#215918PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ Mut1 (BRAF Human)
UseTagsExpressionMammalianMutationBRAFPromoterAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_Mut2-SM
Plasmid#215919PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ Mut2 (BRAF Human)
UseTagsExpressionMammalianMutationBRAFPromoterAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177344PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from doxycycine-inducible promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterTetracycline-dependent promotersAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
CamKII-LGI1-T380A-pHluorin
Plasmid#185543PurposeExpresses mutant T380A LGI1-pHluorin under the CamKII promoterDepositorInsertLGI1 (Lgi1 Rat)
UseLentiviralTagspHluorinExpressionMammalianMutationchanged threonine 380 for alaninePromoterCamKIIAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only