We narrowed to 12,345 results for: nsf
-
Plasmid#119878PurposeBacterial Expression construct for the production and purification of Arc missing C-terminal DomainDepositorInsertActivity Regulated Cytoskeletal Protein (Arc Rat)
TagsGSTExpressionBacterialMutationDeletion of nt 832-1110PromotertacAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/BCR-FGFR1
Plasmid#167490PurposeMammalian expression vector for the BCR-FGFR1 fusion gene associated with myeloid and lymphoid neoplasmsDepositorInsertBCR-FGFR1 (BCR Human)
ExpressionMammalianAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.neo_shGFP
Plasmid#110470PurposeControl, silence GFP gene, doxycycline inducible, neomycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET22-His-TEV-DOT1L
Plasmid#89610PurposeBacterial expression vector for an N-terminally His-tagged (TEV-cleavable) version of human Dot1L residues 1-416DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H30
Plasmid#170337PurposeCFP(UST)_EPACdDEPCD_Y(UST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertCFP(UST)_EPACdDEPCD_Y(UST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGem-sHyper:sAPX
Plasmid#84738PurposeSimultaneous expresion of stromal sHyPer and stromal Ascorbate peroxidase (APX) in plant cellsDepositorInsertsTagsnuclear localisation signals from the coding sequ…ExpressionPlantPromoterpFMV/p35SAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Flag-Apex-Rab7A
Plasmid#135652PurposeRab7A fused to APEX2 and a Flag tag in N-ter under control of a weak L30 promoter.DepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-PGK-Chst3
Plasmid#193024PurposeAAV vector plasmid expressing mouse chondroitin 6-sulfotransferase (Chst3) under the mouse phosphoglycerate kinase (PGK) promoterDepositorAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-mRho.V5.mER.hOr47a
Plasmid#126472PurposeHuman codon-optimized version of D. melanogaster Or47a (hOr47a) with N-terminal tags derived from human Rhodopsin (mRho) and HCN1 (mER) for improved intracellular trafficking in mammalian cellsDepositorInsertOr47a (Or47a Fly)
TagsH. sapiens HCN1 106VNKFSL111 (mER), H. sapiens Rh…ExpressionMammalianMutationcodon optimization for H. sapiensPromoterCMVAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGem-nHyPer:sAPX
Plasmid#84735PurposeSimultaneous expresion of stromal HyPer2 and stromal Ascorbate peroxidase (APX) in plant cellsDepositorInsertsTagsnuclear localisation signals from the coding sequ…ExpressionPlantPromoterFMV/35SAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FuG-B
Plasmid#67523PurposeThis is an envelope gene encoding plasmid to make retrogradely lentiviral vector. You can make type B envelope coating virus particle with HiRet by using this plasmid.DepositorInsertFusion Glycoprotein type B
UseLentiviralTagsFusion protein of Vesicular stomatitis Indiana vi…PromoterCAGGSAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET22-His-TEV-DOT1L-MM
Plasmid#89611PurposeBacterial expression vector for an N-terminally His-tagged (TEV-cleavable) version of human Dot1L hypermorphic MM mutant residues 1-416DepositorAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTN6kwh
Plasmid#44724DepositorInsertspCMV-D2i promoter
htetR::NLS
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDam-Myc-HP1
Plasmid#59221Purposeexpresses Dam-myc-HP1DepositorInsertHP1 (Su(var)205 Fly)
UseDamidTagsDam and mycExpressionInsectPromoterDrosophila heat shock promoterAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3A(E752A)
Plasmid#71213PurposedCas9 fused to BFP and the human DNMT3A catalytically inactive domainDepositorInsertdSpCas9-BFP-DNMT3A(E752A), DNMT3A catalytic domain with inactivation mutation E752A
TagsdSpCas9-BFP-DNMT3A(E752A)ExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJHG003
Plasmid#126454PurposeExpresses Cas9-XTEN-dTdT in mammalian cells.DepositorInsertCas9-XTEN-dTdT (DNTT Streptococcus pyogenes, Human)
ExpressionMammalianMutationAdded D343E and D345E to inactivate TdT.PromoterCMVAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB65 - pL0_tGFP-I (CDS1)
Plasmid#123182PurposeGolden Gate (MoClo; CDS1) compatible turbo GFP gene from P. plumata with an intron for transient and stable expression in plants (moved to a CDS1 position from pICSL50016; Engler et al., 2014)DepositorInsertturboGFP codon-optimised for plants (P. plumata) with intron, U5 small nuclear ribonucleoprotein component (A. thaliana)
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBiex1-SYNAC
Plasmid#82710PurposeSynthetic soluble adenylyl cyclase FRET sensor and cAMP generatorDepositorTagsFLAG, mCerulean, and mCitrineExpressionBacterial and InsectPromoterT7Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-mVenus-FLAG-LANS1-Set2
Plasmid#122003PurposemVenus-FLAG-LANS-Set2: mVenus- and FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInsertmVenus-FLAG-LANS1-Set2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsmVenus-FLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only