173,383 results
-
Plasmid#129591PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody-mCherry (15F11-HA scFv-mCh)
ExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv1(mCherry-FLAG) in pTwist-CMV
Plasmid#216165PurposeExpression of mCherry specifically in cells with TDP-43 knockdown. Uses AARS1-derived cryptic exon to control mCherry expression. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmCherry with C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 WT
Plasmid#16237DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCS2FA-H2B-mScarlet3
Plasmid#224436PurposeConstruct for labelling cell nuclei in mammalian cells using Histon protein 2B fused to mScarlet3DepositorInsertH2B-mScarlet3
ExpressionMammalianPromoterCMV & SP6Available SinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-SREBP-2
Plasmid#26807DepositorInsertSterol Regulatory Element Binding Protein 2 (SREBF2 Human)
Tags2x FLAGExpressionMammalianMutationL7V, G76S, K395R and I482LPromoterCMVAvailable SinceJuly 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCDB327
Plasmid#113671Purposeexpresses Ulp1_R3 in Escherichia coliDepositorInsertUlp1_R3
Tags6-HisExpressionBacterialMutationcontains solubility enhancing mutationsPromoterT7Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIVT_superDn29-dCas9-P2A-GFP
Plasmid#247166PurposeIn vitro transcription of human codon optimized fusion of superDn29-dCas9-P2A-GFPDepositorInsertsuperDn29-dCas9-P2A-GFP
UseIn vitro transcriptionTagsSV40 NLSMutationM6I/E70G/A224P/G227V/I233K/K248R/I303K/Q332K/N341…Promotermutated T7Available SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMU-PMr
Plasmid#61180PurposeFluorescent reporter for plasma membrane AtPIP2a-mCherry expressed under AtUBQ10 promoterDepositorInsertAtPIP2a
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBABE-neo-hTERT
Plasmid#1774PurposeRetroviral expression of hTERT. Used to create immortalized cell lines.DepositorAvailable SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only