We narrowed to 7,777 results for: CCH
-
Plasmid#175205PurposeXenopus oocyte expression vector containing YBR287W. Contains T7 RNA polymerase binding site, and adds polyA tail to YBR287W. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertYBR287W
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8155
Plasmid#175206PurposeXenopus oocyte expression vector containing YCL002C. Contains T7 RNA polymerase binding site, and adds polyA tail to YCL002C. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertYCL002C
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFB8455
Plasmid#175207PurposeXenopus oocyte expression vector containing YCR075C. Contains T7 RNA polymerase binding site, and adds polyA tail to YCR075C. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertYCR075C
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pB6-Id1-IRES-loxP-NeoR-loxP-DTA-TK
Plasmid#158616PurposeB6J Id1-LSL-DTA allele targeting vector, low copy numberDepositorInsertId1 (Id1 Mouse)
UseCre/Lox and Mouse TargetingExpressionMammalianMutationInsertion of IRES-loxP-NeoR-loxP-DTA after the st…Available SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRPL28exon1-(Nhe/Mfe) SpHIS5 (pNTI619)
Plasmid#115432PurposeVector for expressing RPL28 with mutagenized exon2DepositorInsertsExpressionYeastMutationexon 2 deleted, with MfeI / NheI cloning sitePromoterAshbya gospii TEF1 and endogenousAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP105 (pRS416-YBR139Wp-YBR139W-PA-ADH1t)
Plasmid#106461PurposeExpresses Atg42/Ybr139w with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W
TagsPAExpressionBacterial and YeastPromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP135 (pRS406-YBR139Wp-YBR139W-PA-ADH1t)
Plasmid#106470PurposeExpresses Atg42/Ybr139w with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W
TagsPAExpressionBacterial and YeastPromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRevLCav2deltaC
Plasmid#60809Purposeto make truncation of yeast Rev3DepositorInsertREV3 (REV3 Budding Yeast)
ExpressionYeastMutationrev3ΔC encodes for Rev3 lacking the C-terminus (a…Available SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Gal4pBS134-Pleum
Plasmid#60339PurposeContains a promoter of three gal binding sites derived from native galactose promoter coupled with a core promoter derived from native Leucine promoter.DepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promote…ExpressionYeastAvailable SinceFeb. 11, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML104
Plasmid#67638PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains URA3 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSPObooster
Plasmid#216160PurposePlasmid expressing the RME1(ins-308A) and MKT1(30G) genes from S. cerevisiae to correct sporulation defect of S288C derived yeast lab strainsDepositorExpressionYeastMutationMKT1 gene containing an aspartic acid to glycine …Promoterendogenous promoterAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107
Plasmid#67639PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains LEU2 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3 (aka GAP promoter)Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEVA1
Plasmid#58953PurposeContains a synthetic DNA sequence, VAR1u, that specifies the Var1 protein. The Cox4 targeting signal is fused to the N-terminus to direct import of Var1. Complements var1 mutations in mtDNA.DepositorInsertVAR1u, VAR1 recoded for expression from the nucleus
UseYeast ecoli shuttle vectorTagspreCox4 mitochondrial matrix targeting signalExpressionYeastMutationSynthetic gene in standard genetic codePromoterADH1Available SinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDR211
Plasmid#113870Purposeexpression of Cas9 programming sgRNA3 and sgRNA4 targetting HXT8 and HXT1 respectivelyDepositorInsertsgRNA3-HXT8 / sgRNA4-HXT14
ExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR418
Plasmid#113875Purposeexpression of double Cas9 programming sgRNA11 targetting STL1DepositorInsertdoble sgRNA11-STL1
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB8709
Plasmid#175224PurposeXenopus oocyte expression vector containing YOL092W. Contains T7 RNA polymerase binding site, and adds polyA tail to YOL092W. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertYOL092W (CEN.PK strain)
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBY011-AMN1ko
Plasmid#183099PurposeS. cerevisiae Sigma1278b AMN1 gene knock out plasmid with KanMX selection marker.DepositorInsertAMN1 (left homology arm) - KanMX - AMN1 (right homology arm) (AMN1 Budding Yeast)
TagsKanMXExpressionBacterial and YeastMutationonly includes external sequences (504 bp each) as…PromoterURA3, TEF1Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Lrig1-T2A-tdTomato-FNF-TK
Plasmid#134320PurposeB6J Lrig1-T2A-tdTomato allele targeting vector, low copy numberDepositorAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB6-Cdk6-T2A-td-sfGFP-FNF-TK
Plasmid#134321PurposeB6J Cdk6-T2A-td-sfGFP allele targeting vector, low copy numberDepositorInsertCdk6 (Cdk6 Mouse)
UseMouse TargetingTagsC-terminal fusion of T2A-tandem dimer-superfolder…Available SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKP110 [pRS416-YBR139Wp-YBR139W(N163,242Q)-PA-ADH1t]
Plasmid#106462PurposeExpresses Atg42/Ybr139w(N163,242Q) with a C-terminal PA tag in yeast cellsDepositorInsertYBR139W(N163,242Q)
TagsPAExpressionBacterial and YeastMutationchanged Asparagines at positions 163 and 242 to G…PromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP129 [pRS406-YBR139Wp-YBR139W(S219A)-GFP-ADH1t]
Plasmid#106466PurposeExpresses Atg42/Ybr139w(S219A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(S219A)
TagsGFPExpressionBacterial and YeastMutationChanged Serine 219 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP131 [pRS406-YBR139Wp-YBR139W(H474A)-GFP-ADH1t]
Plasmid#106467PurposeExpresses Atg42/Ybr139w(H474A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(H474A)
TagsGFPExpressionBacterial and YeastMutationChanged Histidine 474 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKP133 [pRS406-YBR139Wp-YBR139W(D415A)-GFP-ADH1t]
Plasmid#106468PurposeExpresses Atg42/Ybr139w(D415A) with a C-terminal GFP tag in yeast cellsDepositorInsertYBR139W(D415A)
TagsGFPExpressionBacterial and YeastMutationChanged Aspartate 415 to AlaninePromoterYBR139WAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only