We narrowed to 25,161 results for: promoter
-
Plasmid#209964PurposeContains Level 0 Part: constitutive Promoter (P48) for the construction of Level 1 plasmidsDepositorInsertPromoter (P48)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5 FRT/TO Plk4 KD-mCherry
Plasmid#80270Purposemammalian expression plasmid for kinase dead Plk4DepositorAvailable SinceAug. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_human-4xUAS
Plasmid#125150PurposeVector to measure the activity of CP candidates in response to a tethered (4xUAS) GAL4-DBD-COF by determining the abundance of transcripts originating from each candidate in human cellsDepositorInsert4 x upstream activating sequence (UAS)
UseStap-seq screening vectorAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RAB10 Q68L-WPRE-UbC-Emerald
Plasmid#203803PurposeLentiviral vector plasmid expressing human RAB10 mutation Q68L (constitutively active mutant) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
GST-N1IC
Plasmid#47612Purposebacterial expression of GST-myc-Notch1 ICDepositorInsertNotch1 intracellular domain (Notch1 Mouse)
TagsGST and mycExpressionBacterialMutationcontains amino acids 1753-2531PromotertacAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEBG-TFII-I-p70
Plasmid#22187DepositorInsertTFII-I (GTF2I Human)
TagsGST and HisExpressionMammalianMutationContains only amino acids 1-735 C-terminal residu…Available SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSEM235 - [Pmlc-1 | mcherry | cbr-tbb-2 UTR]
Plasmid#159900PurposeFluorescent co-injection marker to identify extrachromosomal arrays in C. elegansDepositorInsertPmlc-1 | mcherry | cbr-tbb-2 UTR
ExpressionWormPromoterPmlc-1Available SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pANTO5
Plasmid#131106PurposeTo generate an integrative plasmid carrying the TetR/Pip-OFF system, but not the integraseDepositorInserttetR gene by pFRA61 (Boldrin et al 2010)
ExpressionBacterialAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRDA_186
Plasmid#133458PurposeU6 promoter expresses customizable Spyo-guide; PGK promoter expresses blasticidin resistance and 2A site provides EGFPDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn spCas9
Plasmid#179725Purposehuman synapsin (hSyn)-driven spCas9 lentiviral vector for CRISPR/HITIDepositorInsertspCas9
UseLentiviralAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR124
Plasmid#177806PurposeThe pre-miR-124 sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-124
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM6-C4-mCherry
Plasmid#66530PurposeExpresses mCherry under the control of Mutant T7 Promoter C4DepositorInsertmCherry
UseSynthetic BiologyExpressionBacterialMutationCodon Optimized for E. coliPromoterMutant T7 Promoter - C4Available SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPMVAd36
Plasmid#98302PurposeEnhancing the lower-part mevalonate pathway; overexpressing yeast mevalonate pathway genes under the control of consitutive promoters or CUP1 promoter.DepositorInsertPCUP1>ERG12>TNAT5-PTEF2>ERG8>TIDP1-TIDP1ExpressionYeastAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX-V5-TRAF2-puro
Plasmid#44111DepositorAvailable SinceMarch 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-PGK.Pro
Plasmid#79489PurposeMultiSite Gateway entry clones, first fragment, (attL1, attR5) Human PGK promoterDepositorAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
MBP-3C-hNorrin(33-133)-monomeric(C93A/C95A/C131A)-1D4_pAcGP67a
Plasmid#216385PurposeBaculovirus transfer vector to secrete MBP-fused human Norrin (residues 118-218) (monomeric mutant C93A/C95A/C131A)DepositorInsertNorrin (NDP Human)
UseBaculovirusTagsGP64 signal sequence-MBP-3C and Rho1D4ExpressionInsectMutationC93A/C95A/C131APromoterPolyhedrinAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn SYT7alpha
Plasmid#179713PurposeLentiviral expression of mouse Syt7DepositorInsertSYT7 (Syt7 Mouse)
UseLentiviralAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn PP-HaloTag-SYT7alpha
Plasmid#179714PurposeLentiviral expression of mouse Syt7 with N terminal HaloTagDepositorInsertSYT7 (Syt7 Mouse)
UseLentiviralAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only