We narrowed to 7,333 results for: ef1a
-
Plasmid#184949PurposeLentiviral delivery of recombinase landing padDepositorInsertKp03 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1α-sakkhCas9-HA-NLS-polyA-CBh-EGFP-polyA
Plasmid#168305Purposemediated knock-in of sgRNA precursorDepositorInsertSaKKH-EGFP-U6-sgRNA
UseAAVExpressionMammalianPromoterEF1alpha, CBhAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A-HAUS6_IRES_Blast
Plasmid#182886PurposeTransfer vector for production of lentivirus. Expresses EGFP-P2A-HAUS6 (WT full length)DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralTagsEGFPExpressionBacterial and MammalianPromoterEF1alpha coreAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX311-Cas9
Plasmid#118018PurposeConstitutive expression of Cas9DepositorInsertCas9
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJT302 Ec03 Lenti pEF-attB LSR GFP
Plasmid#184945PurposeLentiviral delivery of recombinase landing padDepositorInsertEc03 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT303 Ec04 Lenti pEF-attB LSR GFP
Plasmid#184946PurposeLentiviral delivery of recombinase landing padDepositorInsertEc04 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT304 Ec07 Lenti pEF-attB LSR GFP
Plasmid#184947PurposeLentiviral delivery of recombinase landing padDepositorInsertEc07 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR100
Plasmid#187240PurposeLentiviral sgRNA vector for Perturb-seq with mU6 sgRNA promoter, CR1 constant region with CS1 capture sequence in stem loop, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector for Perturb-seq with mU6 promoter
UseLentiviralAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZ853
Plasmid#208115PurposemSwAP-In marker cassette 2 with 5’PB-mNeongreen-HPRT1-BSDDepositorInsertmNeonGreen-HPRT1-BSD
TagsT2AExpressionBacterial and MammalianPromoterEF1alphaAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDYT001
Plasmid#186549PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)DepositorInsert14-bp random integration barcode and three target sites and 3x sgRNAs
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX209-neo-HA-Ub-T2A-Tet3G
Plasmid#202436PurposeBicistronic expression of HA-tagged Ubiquitin (HA-Ubiquitin) and Tet-On 3G transactivator (Tet3G)DepositorInsertUbiquitin
UseCRISPR and LentiviralExpressionMammalianPromoterEF1alphaAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DM
Plasmid#64880Purposelentiviral expression of human POLQ double mutant (in POL and HDL domains)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationK121M and D2330A,Y2331APromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDYT002
Plasmid#186550PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAsDepositorInsert14-bp random integration barcode and three target sites
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
SOX17-NLS-tdTomato-EPG
Plasmid#210466PurposeDonor plasmid for knock-in NLS-tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived puromycin-EGFP selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV_PP1-mCitrine
Plasmid#172472PurposeMammalian expression of a human codon-optimized version of the optogenetic GPCR parapinopsina (PP1) from zebrafish fused to mCitrine. Also contains an N-terminal prolactin signal sequence.DepositorInsertprolactinSS-PP1-mCitrine (parapinopsina Zebrafish)
UseLentiviralTagsmCitrine and prolactin signal sequence (cleaved p…ExpressionMammalianPromoterEF1alphaAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-full-length-CHMP3-HA
Plasmid#154176Purposeexpresses mouse CHMP3 in mammalian cellsDepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
L4866 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF1a in MGEV
Plasmid#244190PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF1aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF1 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4864 IL-10Rb NTEVp chain, IL-10Ra CTEVp chain with ZF6a in MGEV
Plasmid#244189PurposeMultigene vector for constitutive expression of mTagBFP2, IL-10Rb NTEVp chain with human IgG VH signal peptide, and IL-10Ra CTEVp chain with ZF6aDepositorInsertmTagBFP2; IL-10Rb NTEVp chain with human IgG VH signal sequence; IL-10Ra CTEVp chain with ZF6 synTF
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1a, CMVAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4207 TNFR2 NTEVp chain in PolyTX-mNeonGreen
Plasmid#244175PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): TNFR2SS-3xFLAG-TNFR2ECD-mCD28TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human TNFR2 SS and ECD, murine CD28 TMD, and NTEVp (75S) (TNFRSF1B Human, Synthetic)
UseSynthetic BiologyTagsTNFR2 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-CHMP3(147)-HA
Plasmid#154177Purposeexpresses mouse CHMP3(147) in mammalian cellsDepositorInsertCHMP3 (Chmp3 Mouse)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 147PromoterEF1alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
289aa Met133, 138, 186Ileu ELL2
Plasmid#127272PurposeExpresses 289aa human ELL2 with Met133, 138, 186IleuDepositorInsertELL2 w Met to ILeus stopped at XbaI (ELL2 Human)
ExpressionMammalianMutationMet133, 138, 186 Ileu, cut with XbaI blunt fillinPromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300
Plasmid#191764PurposeExpression of EGFP fused to core p300 histone acetyltransferaseDepositorInsertFRB-EGFP-p300 core (EP300 Human)
TagsEGFP (N-terminal of p300 core) and FRB (N-termina…ExpressionBacterial and MammalianPromoterEF1alphaAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBA904
Plasmid#122238PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAR015 Lenti pEF-dEnAsCas12a-NLS-NFZ-3XHA-T2A-BSD
Plasmid#195544PurposedCas12a effector fusion for manipulating transcriptionDepositorInsertLenti pEF-dEnAsCas12a-NLS-NFZ-3XHA-T2A-BSD
UseCRISPR and LentiviralTags3XHAExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
L4857 dsRedExpress2 reporter, VEGFR2 NTEVp, VEGFR1 CTEVp in PiggyBac Transposon Vector
Plasmid#244187PurposePiggyBac transposon vector for expression of dsRed-Express2 synTF promoter; constitutive expression of VEGFR2 NTEVp chain, VEGFR1 CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRed-Express2 under synTF responsive promoter; VEGFR2 NTEVp chain with WT NTEVp; VEGFR1 CTEVp chain; mNeonGreen-P2A-PuroR
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBA900
Plasmid#122237PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs2 incorporated at the 3' end of the sgRNA constant region.DepositorInsertsgRNA with cs2 at the 3' end of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only