We narrowed to 66,696 results for: nin
-
Plasmid#53270PurposeContains 3 genes (crtE, crtI, and crtB) of the carotenoid pathway gene cluster of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces lycopene in Escherichia coliDepositorInsertcrtE, crtI, crtB
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterendogenous promotersAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-CANTHipi
Plasmid#53301PurposeContains crtE, idi, crtI, crtY, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and a crtO cDNA of Haematococcus pluvialis fused to a Trc promoter. Produces canthaxanthin in E. coli.DepositorInsertcrtO
UseLow copy number bacterial cloning vectorTags6HisExpressionMutationPromoterTrcAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-NLRC5
Plasmid#37521DepositorInsertNLRC5 (NLRC5 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
ChromosomesMembranesandCytoskeleton
Plasmid#62450PurposeMXS_chaining vector with 4 cassettesDepositorInsertsCMV::H2B-TagBFPx3-bGHpA
CMV::Lyn-Ceruleanx3-bGHpA
CMV::mCherryx3-linker-betaActin-bGHpA
CMV::Citrinex3-linker-alphaTubulin-bGHpA
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-ZEAXipi
Plasmid#53287PurposeContains crtE, idi, crtI, crtY, crtB, and crtZ genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces zeaxanthin in E. coliDepositorInsertcrtE, idi, crtY, crtI, crtB, crtZ
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterendogenous promotersAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA-At
Plasmid#53288PurposeContains crtE, crtB, and crtI genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and an lcyB cDNA of Arabidopsis thaliana. Use with pY2F to produce alpha-carotene in E. coli.DepositorInsertlcyB (LYC Mustard Weed)
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoternoneAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAC-aZEA
Plasmid#53286PurposeContains crtE, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, crtI gene of Rhodobacter capsulatus, and lcyE cDNA of Arabidopsis thaliana and produces alpha-zeacarotene in E. coliDepositorInsertlcyE (LUT2 Mustard Weed)
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterlacAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAPi
Plasmid#127548PurposeEmpty control for pGAPi-based RNAi silencing in tandem with APT transcript segmentDepositorInsertAdenine Phosphorybosyltransferase transcript segment
UseRNAi; Empty controlTagsExpressionMutationPromoterUbiquitinAvailable sinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
p11_AaC60αβ/C20
Plasmid#229506PurposeExpresses Anthoceros agrestis Chaperonin 60α, Chaperonin 60β, Chaperonin 20DepositorInsertsChaperonin 60α
Chaperonin 60β
Chaperonin 20
UseTagsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available sinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAC-BETA
Plasmid#53272PurposeContains crtE, crtB, crtI, and crtY carotenoid pathway genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces beta-carotene in Escherichia coliDepositorInsertcrtE, crtY, crtI, crtB
UseLow copy number bacterial cloning vectorTagsExpressionMutationPromoterendogenous promotersAvailable sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable sinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionTagsExpressionMutationPromoterT3 promoterAvailable sinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTEX150-bio
Plasmid#47788PurposeExpresses enzymatically monobiotinylated full-length PTEX150 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PTEX150
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RhopH2-bio
Plasmid#47798PurposeExpresses enzymatically monobiotinylated full-length RhopH2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RhopH2
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMammalianMutationPromoterU1a and U6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-Fluoro-Phe D6
Plasmid#197577PurposeExpression of Methanosarcina barkeri (Mb) Fluoro-Phe D6 tRNA synthetase/Pyl-tRNA pair for the encoding of fluorinated phenylalanine derivatives at TAG codons in HEK293 cellsDepositorInsertsMb Pyl Fluoro-Phe B5 synthetase
Pyl-tRNA (4 copies)
UseTagsNuclear export sequence + FLAGExpressionMammalianMutationN311A, C313M, V366G, W382TPromoterCMV and U6/H1Available sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-Fluoro-Phe B5
Plasmid#197576PurposeExpression of Methanosarcina barkeri (Mb) Fluoro-Phe B5 tRNA synthetase/Pyl-tRNA pair for the encoding of fluorinated phenylalanine derivatives at TAG codons in HEK293 cellsDepositorInsertsMb Pyl Fluoro-Phe B5 synthetase
Pyl-tRNA (4 copies)
UseTagsNuclear export sequence + FLAGExpressionMammalianMutationN311G, C313APromoterCMV and U6/H1Available sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
S10A mutant of H3S10ph biosensor
Plasmid#120810PurposeFRET biosensor. Eliminating the H3 Serine 10 phosphorylation site in H3S10ph biosensor to abolish the detection capabilityDepositorInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa) S10A-YFP
UseTagsExpressionMammalianMutationSerine 10 is mutated to Alanine, and Threonine 3,…PromoterCMVAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
WT MetNIQ in pBAD
Plasmid#118253PurposeWild Type Methionine Binding Protein and Methionine ABC Transporter in pBAD Vector for Transport Activity AssayDepositorUseTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala)PromoterNone and araBAD PromoterAvailable sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN) MetNIQ in pBAD
Plasmid#118256PurposeN295A Mutation of MetN in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorUseTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Asparagine (Asn) 295 to Alanine (Ala)PromoterNone and araBAD PromotoerAvailable sinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), Y160A (EcI) MetNIQ in pBAD
Plasmid#118260PurposeN295A Mutation of MetN and Y160A in MetI in Methionine ABC Transporter for Transport Activity AssayDepositorUseTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-MCS-WPRE-SV40 - GCH1
Plasmid#230814PurposeAAV cloning vector for expression under the CAG promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorTagsExpressionMutationPromoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-MCSrev-WPRE-SV40 - GCH4
Plasmid#230832PurposeAAV cloning vector for expression under the CAG promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorTagsExpressionMutationPromoterAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-MCS-WPRE-SV40 - GCH13
Plasmid#230820PurposeAAV cloning vector for expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorTagsExpressionMutationPromoterAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-FLEX-MCS-WPRE-SV40 - GCH2
Plasmid#230815PurposeAAV cloning vector for CRE-dependent expression under the CAG promoter.DepositorTypeEmpty backboneUseAAV and Cre/Lox; Cloning vectorTagsExpressionMutationPromoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-FRT-MCS-WPRE-SV40 - GCH3
Plasmid#230816PurposeAAV cloning vector for Flpo-dependent expression under the CAG promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorTagsExpressionMutationPromoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FRT-MCS-WPRE-SV40 - GCH15
Plasmid#230822PurposeAAV cloning vector for Flpo-dependent expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorTagsExpressionMutationPromoterAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-Flex-MCS-WPRE-SV40 - GCH14
Plasmid#230821PurposeAAV cloning vector for CRE-dependent expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV and Cre/Lox; Cloning vectorTagsExpressionMutationPromoterAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only