We narrowed to 7,279 results for: gnal
-
Plasmid#220614PurposeCre-dependent co-expression of 3x HA-tagged excitatory hM3D(Gq) DREADD receptor, and a single-cell discriminating version of oScarlet as a reporter.DepositorInsert3x HA-hM3D(Gq)-P2A-AgiNLS-oScarlet
UseAAV and Cre/LoxTags3x HA; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Tras heavy chain-GSG-SpyTag003
Plasmid#216292PurposeExpresses anti-HER2 Tras Heavy chain-GSG-SpyTag003 in mammalian cells. To be paired with Tras light chain to form the anti-HER2 Tras FabDepositorInsertTras heavy chain-GSG-SpyTag003
UseAffinity Reagent/ AntibodyTagsHis6 tag, Signal peptide, and SpyTag003ExpressionMammalianPromoterT7 promoterAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-6XPRE-GFP
Plasmid#206171PurposepMVP Gateway destination vector (3rd generation lentiviral vector) containing 6 consensus PGR binding sites upstream of a minimal 2YBTATA promoterDepositorInsert6X PRE-eGFP
UseLentiviralPromoter2YBTATAAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin S268A/270A
Plasmid#199608PurposeEncodes N-terminal eGFP-tagged P1-gephyrin S268/270A for expression in mammalian cells.DepositorAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_attR1-ORF-attR2-V2R-NTEV-TCS-GV-2xHA_DEST
Plasmid#194386PurposeGateway Destination vector for GPCR split TEV assays with V2R tailDepositorInsertattR1-ORF-attR2-V2R-NTEV-TCS-GV-2xHA
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-TSC2-NLS
Plasmid#192441PurposeEncodes mCherry-tagged wild-type TSC2 isoform 5 targeted to the nucleus.DepositorInsertmCherry-TSC2-NLS (TSC2 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBR1_pLENTI-CAG-IRES-GFP
Plasmid#177008PurposeMammalian lentiviral expression vector encoding CBR1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
HMGN1_pcDNA6.2/EmGFP-Bsd
Plasmid#176943PurposeMammalian expression vector encoding HMGN1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RLuc8C-FHA1-NES
Plasmid#138210PurposeEncodes PAABD fragment of luminescence-based bimolecular kinase activity reporters (LumKARs); cytosol targeted.DepositorInsertRLuc8C-FHA1-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-PKAsub-RLuc8N-NES
Plasmid#138211PurposeEncodes substrate fragment of luminescence-based bimolecular PKA activity reporter (LumAKAR); cytosol targeted. Use in conjunction with pcDNA3-RLuc8C-FHA1-NES.DepositorInsertmCherry-PKAsub-RLuc8N-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR
Plasmid#123346PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertCerulean3-Cerulean3-FLARE-CKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-EKAR-EV
Plasmid#123342PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertCerulean3-Cerulean3-FLARE-EKAR-EV
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-mCherry-FLARE-EKAR-EV
Plasmid#123341PurposeRed-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertmCherry-mCherry-FLARE-EKAR-EV
Tags6xHIS, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-Venus-FLARE-AKAR
Plasmid#123331PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertVenus-Venus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, and Xpress…ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBB0323-TEV-His12
Plasmid#137039Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BB0323 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66700.1
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
hKCNB1 L211P
Plasmid#124487Purposemissense mutation in children with EOEE. HA tagged in C-terminus, pCIneo vectorDepositorInserthuman KCNB1 (KCNB1 Human)
TagsHAExpressionMammalianMutationchanged leucine 211 to prolineAvailable SinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
hKCNB1 G381R
Plasmid#124490Purposemissense mutation in children with EOEE. HA tagged in C-terminus, pCIneo vectorDepositorInserthuman KCNB1 (KCNB1 Human)
TagsHAExpressionMammalianMutationchanged glycine at 381 to arginineAvailable SinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
hKCNB1 F416L
Plasmid#124491Purposemissense mutation in children with EOEE. HA tagged in C-terminus, pCIneo vectorDepositorInserthuman KCNB1 (KCNB1 Human)
TagsHAExpressionMammalianMutationchanged phenyalanine 416 to leucineAvailable SinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only