We narrowed to 10,056 results for: transfer
-
Plasmid#101064PurposeAAV vector expressing CaMPARI2_L398T (Kd = 825nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2_L398T
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Chronos-GFP
Plasmid#58805PurposeAAV expression of Chronos-GFP under the CaMKII promoterDepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-taCasp3-TEVp
Plasmid#45580DepositorHas ServiceAAV1 and AAV5InsertsUseAAV; Adeno associated viral vectorMutationLinker replaced with a TEV protease cleavage sitePromoterEF1aAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_nLightG2
Plasmid#221672PurposeExpresses nLightG2 in neuronsDepositorInsertnLightG2
UseAAVExpressionMammalianAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn Con/Fon EYFP
Plasmid#55650PurposeCre-on/Flp-on EYFP under the Synapsin promoterDepositorHas ServiceAAV Retrograde and AAV8InserteYFP with introns
UseAAV; Cre on/flp on eyfpExpressionMammalianPromoterhSynAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-eGFP
Plasmid#62518PurposeExpresses GFP under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing procedures.DepositorInserteGFP
UseAAVExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_nLightG2-control
Plasmid#221674PurposeExpresses nLightG2-control in neuronsDepositorInsertnLightG2-control
UseAAVExpressionMammalianAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE N-terminal
Plasmid#137175PurposeAAV genome: expresses the N-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE N-terminal; U6-protospacer
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-fDIO-Cre
Plasmid#121675PurposeExpresses Cre recombinase and HA tag in a Flp dependent fashion (fDIO)DepositorHas ServiceAAV Retrograde, AAV1, AAV5, AAV8, and AAV9InsertNLS-CRE-HA
UseAAVTags3xHA and SV40-NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTight-9-124-BclxL
Plasmid#60857Purpose2nd generation lentiviral transfer plasmid. Expresses a synthetic cluster of miR-9/9* and miR-124 fused to Bcl-xL under a doxycycline-inducible promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ATLASsnCre
Plasmid#232351PurposeAnterograde transsynaptic tracer protein to express in presynaptic glutamatergic neurons, Cre payload. Must use with AAV8-DIO-Reporter viruses infected in postsynaptic cells.DepositorHas ServiceAAV5InsertATLASsnCre
UseAAVTagsALFA-TagPromoterhSynAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-SOD2-2A-Catalase-WPRE
Plasmid#67635PurposeAAV vector expressing both SOD2 and mitochondrial targeted CatalaseDepositorUseAAVMutationDeleted the Peroxisome Targeting Signal from Cata…PromoterCMVAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-mCherry-IRES-Cre
Plasmid#55632PurposeExpresses Cre in Mammalian CellsDepositorHas ServiceAAV Retrograde and AAV8InsertsmCherry
Cre
UseAAVExpressionMammalianPromoterEf1a and Ef1a/IRESAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-ATLASsnFlp
Plasmid#232352PurposeAnterograde transsynaptic tracer protein to express in presynaptic glutamatergic neurons that express Cre, Flp payload. Must use with AAV8-fDIO-Reporter viruses infected in postsynaptic cells.DepositorHas ServiceAAV5 and AAV8InsertATLASsnFlp
UseAAVTagsALFA-TagPromoterhSynAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
YY206: pAAV_hSyn::GEMINI(B)-p2A-GEMINI(A)_UbC::HaloTag-GEMINI(A)
Plasmid#228886PurposeAAV plasmid expressing the two GEMINI building blocks (A and B) in an equimolar ratio under the control of a hSyn promoter, and HaloTag-GEMINI(A) under the control of a UbC promoter.DepositorInsertGEMINI(A); GEMINI(B); HaloTag-GEMINI(A)
UseAAVTagsHaloTagExpressionMammalianPromoterhSyn; UbcAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1484 - pAAV SYN1 HA-hM4D(Gi)
Plasmid#121538PurposeAn adeno-associated viral vector expressing HA-tagged inhibitory DREADD (hM4D(Gi)) from a synapsin promoterDepositorHas ServiceAAV2 and AAV5InsertHA-tagged hM4D(Gi) (CHRM4 Human)
UseAAVTagsHAExpressionMammalianPromoterSYN1Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO hChR2(H134R)-EYFP
Plasmid#55639PurposeFlp-Dependent ChR2-EYFPDepositorHas ServiceAAV RetrogradeInserthChR2(H134R)-EYFP
UseAAVTagsEYFPExpressionMammalianPromoterEf1aAvailable SinceAug. 5, 2014AvailabilityAcademic Institutions and Nonprofits only