We narrowed to 11,246 results for: ENA
-
Plasmid#231988PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXW109Hg(RS-RinA-E11)2
Plasmid#123151PurposeMercury sensor with three-layered amplifier cascade. Need to work with plasmid pXWP11-gfp2. pSB4A3 carrying J109-32merR-t-PmerT-30hrpR-30hrpS-t-PhrpLE-30RinA(ASV)-t-PrinA-33ECF11-tDepositorInsertJ109-32merR-t-PmerT-30hrpR-30hrpS-t-PhrpLE-30RinA(ASV)-t-PrinA-33ECF11-t
UseSynthetic BiologyExpressionBacterialPromoterJ109, PmerT, PhrpLE, PrinAAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7f-5p
Plasmid#103156PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7f-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7f-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-FLAG-CRBN-pGK-HYG
Plasmid#107374PurposeLentiviral expression of FLAG-CRBNDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
AA183
Plasmid#216025PurposeFragmid fragment: (Cas protein) for prime editing; R221K;N394K for increased efficiencyDepositorHas ServiceCloning Grade DNAInsertnCas9 (H840A)_v2.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-Cezanne2 (OTU+UBA, aa 1-462)
Plasmid#61582PurposeExpresses human Cezanne2 (OTU+UBA domains) in E. coli.DepositorInsertCezanne2 (OTUD7A Human)
TagsHis6-GST-3CExpressionBacterialMutationIsoform 2. Deleted aa 463-933.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_AURKB
Plasmid#111682PurposeMAC-tagged gene expressionDepositorInsertAURKB (AURKB Human)
ExpressionMammalianAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC49-puro
Plasmid#231989PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-miniTurbo-NES-YFP
Plasmid#127369PurposeBinary vector for expressing cytosolic miniTurbo-YFP under the UBQ10 promoter in plantsDepositorInsertminiTurbo (BirA mutant)
TagsGS linker, NES, V5, and YFPExpressionPlantMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRAV25
Plasmid#237982PurposeEncodes TRAV25 allele, P2A, and TRBC to generate TCRs via cloningDepositorAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-DAXX-ΔD/E-His
Plasmid#179618PurposeExpress GST-DAXX-ΔDE-His in bacteriaDepositorInsertdeath domain associated protein (DAXX Human)
TagsHisExpressionBacterialMutationdeleted amino acids 424-495Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HaloAKAR2.1-NES-T2A-EGFP-CAAX
Plasmid#216491PurposeExpression of chemigenetic PKA biosensor (medium basal brightness, high dynamic range) and PM targeted EGFP in mammalian cellsDepositorInsertHaloAKAR2.1
TagsNES, T2A-EGFP-CAAXExpressionMammalianPromoterCMVAvailable SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-hSox2
Plasmid#20073DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pENTR-eGFP-attP(bxb)-*BsdR
Plasmid#183751PurposeBxb1 landing pad cassette.DepositorInsertloxP-eGFP-attP-Bsd-lox251
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcs2-HRI-GFP-IRES-mCherry
Plasmid#226099PurposeHRI stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-DAXX-D/E-His
Plasmid#179619PurposeExpress DAXX D/E region in bacteriaDepositorInsertdeath domain associated protein (DAXX Human)
TagsGST, His, and TEVExpressionBacterialMutationamino acids 414-505 of DAXXAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P2R-P3_R2-Turbo-NES-mVenus-STOP-L3
Plasmid#127353Purposegateway entry vector for making C-terminal TurboID-mVenus fusion with non-nuclear proteinsDepositorInsertTurboID (BirA mutant)
UseGateway entry vectorTagsGS linker, NES, V5, and mVenusMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…Promoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAN056
Plasmid#220052PurposeReporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (positive control).DepositorInsertfLuc-CFTR (exons 22-27) (CFTR Human)
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only