We narrowed to 5,415 results for: PEP;
-
Plasmid#23460DepositorInsertRPS6KC1 (RPS6KC1 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+CMV-Ins-GLuc
Plasmid#89929PurposeExpresses Insulin-GLuc from the CMV promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.DepositorInserthuman insulin-Gaussia-Luciferase (INS Human, Synthetic)
UseTagsExpressionMammalianMutationDNA sequence for Gaussia luciferase was humanized…PromoterCMVAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-DuET
Plasmid#213221PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCXCR4 (CXCR4 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCR6-DuET
Plasmid#213202PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCCR6 (CCR6 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
18065-M03-412
Plasmid#225666PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGExpressionMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-ctd-Cas9n-UGI-NLS
Plasmid#109426PurposeExpresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
UseCRISPRTagsExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag RPSK6A3
Plasmid#20627DepositorInsertRPSK6A3 (RPS6KA3 Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PIK4CA
Plasmid#23541DepositorInsertPIK4CA (PI4KA Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
AP-APP
Plasmid#196706PurposeExpresses APP695 with a biotin Acceptor Peptide tag at N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsAP, Avitag and HAExpressionMammalianMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PIK3CG
Plasmid#20574DepositorInsertPIK3CG (PIK3CG Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Human, Zebrafish)
UseZebrafish expressionTagsmCherryExpressionMutationPromoterCMVAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPL001-BBTK
Plasmid#184751PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD. Harbors a backbone counterselectable TK cassette.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…TagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PIK3CB
Plasmid#20573DepositorInsertPIK3CB (PIK3CB Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-PDGFRA-reporter
Plasmid#136456PurposeMammalian fluorescent reporter plasmid for PDGFRA signaling.DepositorInsertsPDGFRalpha (PDGFRA Human)
Array of serum response elements (SRE) to drive destabilized GFP expression from a minimal promoter.
UseTagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationPromoterCMV and Minimal promoter with artificial SRE enha…Available sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag RPS6KA5
Plasmid#20622DepositorInsertRPS6KA5 (RPS6KA5 Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PIK4CB
Plasmid#20578DepositorInsertPIK4CB (PI4KB Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UC-Cas9-T2A-mCherry
Plasmid#135014PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to C-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
UseTags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the C-termi…PromoterCBhAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
DNA-CARzeta-GFP
Plasmid#89344Purpose2nd generation lentiviral vector which expresses DNA-CAR receptor fused to GFPDepositorUseLentiviralTagsSNAPf tag and mEGFPExpressionMammalianMutationPromoterAvailable sinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
Plasmid#135013PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
UseTags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only