We narrowed to 24,502 results for: crispr
-
Plasmid#59990PurposeU6 promoter driving Ebf.774 (F+E) sgRNADepositorInsertEbf.774 (F+E) sgRNA
UseCRISPRPromoterCiinte.U6Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7mitfagRNA
Plasmid#47931Purposein vitro transcription of mitfa gRNADepositorInsertmitfa gRNA (mitfa Zebrafish)
UseCRISPRAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNR4A1-donor
Plasmid#112295PurposeCRISPR donor plasmid to tag human transcription factor NR4A1 with GFPDepositorInsertNR4A1 homology arms flanking EGFP-IRES-Neo cassette (NR4A1 Human)
UseCRISPRMutationhg38:12:52058840:C>T, hg38:12:52058930:A>C,…Available SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 gRNA4 (FWA)
Plasmid#120249PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pYZ173
Plasmid#98410PurposeCas9-gRNA lys9 plasmid for lys9 deletion in S. pombeDepositorInsertgRNA targeting Sp.lys9 (SPBC3B8.03 Fission Yeast)
UseCRISPRAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver4.0
Plasmid#176543PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver4.0
Cas12f-GE ver4.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNHEJ-recAmu-sacB
Plasmid#158717PurposeCRISPR-assisted-NHEJ system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses NHEJ machinery of M. marinum and recAR61C allele.DepositorInsertrecA
ExpressionBacterialMutationR61CAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEVA-gRic6T
Plasmid#106401PurposeE.coli-Pseudomonas putida KT2440 shuttle plasmid containing sgRNA targeting the KT2440 genome, and homologous arms.DepositorInsertsgRNA
ExpressionBacterialPromoterpj23119Available SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
P823_eSpCas9(1.1)-RecA
Plasmid#87264PurposeHuman codon optimized RecA protein was fused to eSpCas9(1.1) for enhanced genome editing efficiencyDepositorInsertRecA
TagsFLAGExpressionMammalianPromoterCBhAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
PINK1 gRNA (BRDN0001145357)
Plasmid#78036Purpose3rd generation lentiviral gRNA plasmid targeting human PINK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001149021)
Plasmid#77864Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001148608)
Plasmid#77539Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRD4 gRNA (BRDN0001147320)
Plasmid#77344Purpose3rd generation lentiviral gRNA plasmid targeting human BRD4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK9 gRNA (BRDN0001146478)
Plasmid#77169Purpose3rd generation lentiviral gRNA plasmid targeting human CDK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AKT3 gRNA (BRDN0001146868)
Plasmid#76217Purpose3rd generation lentiviral gRNA plasmid targeting human AKT3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY019 (pcDNA3.1-hPmCpf1)
Plasmid#69991PurposeExpresses humanized PmCpf1DepositorInserthPmCpf1
UseCRISPRTagsNLS-3xHAExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pY015 (pcDNA3.1-hLiCpf1)
Plasmid#69987PurposeExpresses humanized LiCpf1DepositorInserthLiCpf1
UseCRISPRTagsNLS-3xHAExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only