We narrowed to 14,369 results for: TIM
-
Plasmid#185476PurposeFluorescent reporter for a 5 basepair deletion at the HEK3 locus.DepositorInsertHEK3 editing site
ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hTRF2
Plasmid#103804PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhTRF2: deletion of amino acids 1-42 and 476 compa…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001148961)
Plasmid#77967Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001145317)
Plasmid#77965Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001487120)
Plasmid#77966Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HsTPC2-EYFP
Plasmid#135194PurposeExpresses tagged TPC2 in mammalian cellsDepositorAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
FGFR1-optoDroplet
Plasmid#111509PurposeFor optogenetic clustering of FGFR1DepositorInsertFGFR1 (FGFR1 Human)
UseLentiviralTagsCry2, FUS, Fusion Red, and Myristoylation sequenc…PromoterSFFVAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRQR-P2A-EGFP (RTW3161)
Plasmid#139992PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRQR(D1135V/G1218R/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRQR=D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 GFP V3
Plasmid#226962PurposeCBh-SaCas9-2A-GFP, and hU6-sgRNA (Sa) with a BbsI golden gate cloning backbone for sgRNA. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Retro-Puro-Drp1-shRNA
Plasmid#99385PurposeExpresses shRNA against human Drp1 from puromycin resistance retroviral vectorDepositorAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRIM28 gRNA (BRDN0001162487)
Plasmid#76139Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
R619-M87-303: CMV51p> SARS-CoV S-2P-T4f-3C-His8-Strep2x2
Plasmid#166012Purposemammalian expression of SARS-CoV soluble spike trimer proteinDepositorAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2K7-bsd-UBI-tagRFP-KDEL
Plasmid#114179PurposeLentiviral vector for expression of tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseLentiviralTagsKDEL retention signal and signal peptideExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO5-pcDNA3.1-
Plasmid#52509Purposeexpresses human FbxO5 in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX(frt)-GCaMP6f-WPRE
Plasmid#118273PurposepAAV vector for flippase dependent GCaMP6f expression under the control of EF1a promoterDepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…ExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-MCP-huADARE488QT490A
Plasmid#159922PurposeFusion of MS2 coat protein to Human ADAR2 E488QT490A, under Ef1a promoter, with WPRE. AKA 116v5DepositorAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRIB2 gRNA (BRDN0001144754)
Plasmid#75602Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIB2 gRNA (BRDN0001148141)
Plasmid#75603Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a(CTLA4)
Plasmid#177905PurposeBacterial expression of his10-tagged human CTLA4 Intracellular DomainDepositorInsertCTLA4 (aa 183-223 only) (CTLA4 Human)
Tags10xHis-Thrombin cut site-T7 tagExpressionBacterialPromoterT7Available SinceMay 18, 2024AvailabilityAcademic Institutions and Nonprofits only