We narrowed to 14,064 results for: CAN
-
Plasmid#192278PurposeEntry vector for cloning MmCas12m spacers. RFP flanked by MmCas12m CRISPR repeats can be digested out with BbsI.DepositorInsertRFP flanked by type V-M CRISPR repeat sequences
UseCRISPRExpressionBacterialPromoterPJ23119Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFPZNF598-9P-9A
Plasmid#141192PurposeExpresses GFP-ZNF598 mutated in polyproline streches in mammalian cells, can be used to make inducible cell lineDepositorInsertZNF598 (ZNF598 Human)
TagsGFPExpressionMammalianMutationall 3 proline repeats are mutated to Alanine (9xP…PromoterCMVAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPbcas13b
Plasmid#89906PurposeBacterial expression for pbCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
ExpressionBacterialPromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LtR-wt(TAG)
Plasmid#217366PurposeExpresses E. coli leucine tRNA and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA for TAG suppression
UseAAVExpressionMammalianPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmRFP-N1 human cofilin R21Q
Plasmid#51279Purposeexpresses human cofilin R21Q mutant fused to mRFP in mammalian cellsDepositorInsertcofilin 1 (CFL1 Human)
TagsmRFPExpressionMammalianMutationR21Q, non-rod-forming mutation that can be used t…PromoterCMVAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER13 (miR-LUP)
Plasmid#46936PurposeInducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoRI; 1.4kb), can be replaced w mir30 based hairpin of interestDepositorInsertPheS Gly294
UseLentiviralAvailable SinceNov. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pC0047-CMV-dPspCas13b-ADAR1DD(E1008Q)
Plasmid#103863PurposedPspCas13b-ADAR1DD(E1008Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNADepositorInsertsUseCRISPRExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO-OFF-ArgiNLS-oScarlet
Plasmid#220606PurposeFlp-independent expression of a single-cell discriminating version of oScarlet fluorescent protein. Flp activity can turn off expression.DepositorInsertoScarlet
UseAAVTagsArgiNLSExpressionMammalianPromoterCAGAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer-TAZ-S89A
Plasmid#213588PurposeDoxycycline inducible expression of TAZ-S89A cDNA in mammalian cellsDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-VenusYFP-3AT
Plasmid#71269PurposeEntry clone containing Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertVenusYFP
UseGatewayTags4xGly linker and T3A pea Pisum sativum ribulose-1…Available SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER12 (miR-RUL)
Plasmid#46935PurposeInducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoRI;1.4kb),can be replaced w mir30 based hairpin of interestDepositorInsertPheS Gly294
UseLentiviralAvailable SinceNov. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-GIGYF1
Plasmid#141188PurposeExpresses GFP-GIGYF1 in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer-TAZ-S89A/S311A
Plasmid#213589PurposeDoxycycline inducible expression of TAZ-S89A/S311A cDNA in mammalian cellsDepositorAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
1073A(HomeR1)=pBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
Plasmid#159676PurposePlasmid provides the HomeR#1 gene drive element harboring a rescue, gRNA#1, and 3xP3-eGFP that can be integrated via pBac and inserted at Pol-γ35 site #1 via HDR.DepositorInsertpBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
ExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaCRIM
Plasmid#124921PurposeFor expression of Conserved Region In Middle deletion mutant of SIN1-GFP (delta139-267)DepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaPH
Plasmid#124922PurposeFor expression of Pleckstrin Homology domain deletion mutant of SIN1-GFP (delta376-486)DepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-3xVenusYFP-OcsT
Plasmid#71271PurposeEntry clone containing three repeats of Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsert3 times VenusYFP
UseGatewayTagsoctaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only