We narrowed to 5,779 results for: chia
-
Plasmid#216413PurposeExpresses the genetically encoded, chemigenetic hydrogen peroxide sensor oROS-HT in mamalian cells.DepositorInsertoROS-HT
ExpressionMammalianPromoterCMVAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAT-YFP-TetR
Plasmid#59018PurposeExpresses a fusion of yellow fluorescent protein (YFP) to the N-terminus of the Escherichia coli Tn10 tet repressor (TetR) driven by the alpha tubulin promoter for use in T. gondiiDepositorInsertYFP-TetR
UseToxoplasma expressionPromoteralpha-tubulinAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
RGB-S reporter
Plasmid#207841PurposeA three-colour stress biosensor for real time analysis of physiological stress, genotoxicity, and cytotoxicity of Escherichia coliDepositorInsertsRpoH sensing construct
SOS sensing construct
RpoS sensing construct
ExpressionBacterialPromoterPosmY, PsulA, and grpEAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB
Plasmid#162572PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency.DepositorInsertsLambda Red-Beta
E. coli SSB
ExpressionBacterialPromoterpBADAvailable SinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMM643
Plasmid#112533PurposepZE2-PLhrtO-lux-hrtR-RBS3-chuA - HrtR RBS variant of plasmid pMM627 (Strength 33545.5 AU), ColE1 origin, KanRDepositorInsertsHrtR
ChuA
luxCDABE
ExpressionBacterialMutationA17PPromoterJ23107, PL(HrtO), and ProDAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-EcSTH-FLAG
Plasmid#218628PurposeThis plasmid contains human codon optimized sequence of EcSTH which is a soluble transhydrogenase from E. coli that can be used to increase NADH/NAD+ ratio in mammalian cells.DepositorInsertEcSTH
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
Tags6xHis Tag and TEV Cleavage SiteExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-mitoEcSTH-FLAG
Plasmid#218629PurposeThis plasmid contains human codon optimized sequence of mitoEcSTH which is a soluble transhydrogenase from E. coli that can be used to increase NADH/NAD+ ratio in mammalian cells.DepositorInsertmitoEcSTH
UseLentiviral and Synthetic BiologyTagsFLAG and MTSExpressionMammalianAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC3.1_CMV_oROS-G_LF(C199S)
Plasmid#216112PurposeExpresses the loss-of-function mutations C199S of the genetically encoded green fluorescent hydrogen peroxide sensor oROS-G in mamalian cells.DepositorInsertoROS-G_LF(C199S)
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1-recA56
Plasmid#89962PurposeModified from pEM-Cas9HF1 (Addgene ID: 89961) to include constitutive recA56 to block recA-mediated double-strand break repair.DepositorInsertsCas9HF1
recA56
ExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTet and proDAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-BioID-FAM21
Plasmid#121046PurposeExpresses GFP tagged BioID and human FAM21C in mammalian cellsDepositorInsertsTagsGFPExpressionMammalianMutationR118G (highly promiscuous form)PromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPing
Plasmid#47100PurposeExpresses the Ping open reading frame 1 (ORF1) and transposase from rice to allow mPing movement. The vector contains ORF1, transposase, mPing element and hph for hygromycin selection.DepositorInsertsPing cDNA
mPing
hygromycin resistance gene
UsePlant expressionTagsGFPExpressionYeastPromoterCaMV35s and StUbi3Available SinceSept. 16, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDEST-HisMBP-SED1
Plasmid#178191PurposeSED1 biosensor for expression in Escherichia coliDepositorInsertSED1 biosensor
Tags6xHis-MBPExpressionBacterialPromotertacAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniABEmax (pRZ900)
Plasmid#131311PurposeCMV promoter expression plasmid for bpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (ABEmax with truncation of WT TadA domain).DepositorInsertbpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-PTuner DD-M.EcoGII-v5-Telomeric repeat-binding-factor1
Plasmid#122084PurposeExpress M.EcoGII fused to TRF1 with detabilization domain - inducibleDepositorInsertDD-linker-M.EcoGII-V5-TERF1
UseRetroviralTagsV5 tag on Nter of TERF1ExpressionBacterial and MammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB1163
Plasmid#210032PurposeContains Cas3 gRNA cloning site, inducible Cas11-P2A-Cas6-T2A-Cas3, rtTA-T2A-blastDepositorInsertsCas11-P2A-Cas6-T2A-Cas3
rtta-T2A-blast
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-spTorA-GFP-H6C
Plasmid#168517PurposeGFP with the signal peptide of TorA (spTorA) in pBAD24. Includes a C-terminal HHHHHHC (6xHisC) extension.DepositorInsertspTorA-GFP-H6C
Tags6xHisC tag and spTorA (signal peptide of E. coli …ExpressionBacterialMutationThe mut3 GFP variant with 5 additional mutations …PromoteraraBADAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LpIA(wild-type)
Plasmid#61821PurposeEncodes a wild-type sequence of LplA and serves as the negative control for resorufin labelingDepositorInsertE. coli lipoic acid ligase
Tags6XHis, EGFP, and FlagExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
ScSpe1 pET-20b(+)
Plasmid#117145PurposeExpresses the His tagged Saccharomyces cerevisiae Ornithine Decarboxylase in Escherichia coli BL21DepositorInsertSPE1
TagsHistidineExpressionBacterialPromoterT7Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only